- Materials
-
- 10 ng of cDNA amplicons prepared using 10X Genomics Next GEM Single Cell 3' Kits (V3.1)
- Custom-ordered oligo at 10 μM: [Btn]Fwd_3580_partial_read1_defined_for_3'_cDNA (sequence provided below)
- Custom-ordered oligo at 10 μM: Rev_PR2_partial_TSO_defined_for_3'_cDNA (sequence provided below)
- Ligation Sequencing Kit V14 (SQK-LSK114)
- PCR Expansion (EXP-PCA001)
- Consumables
-
- PromethION Flow Cell (FLO-PRO114M)
- LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S)
- NEBNext® Ultra II End Repair / dA-tailing Module (NEB, E7546)
- NEBNext® Quick Ligation Module (NEB, E6056)
- Qubit 1x dsDNA HS Assay Kit (ThermoFisher, Q33230)
- Agilent Technologies DNA 12000 Kit
- M280 streptavidin, 10 μg/μl (Invitrogen, 11205D)
- Agencourt AMPure XP beads (Beckman Coulter™, A63881)
- 1 M Tris-HCl, pH 7.5
- 5 M NaCl (Sigma, 71386)
- 0.5 M EDTA, pH 8 (Thermo Scientific, R1021)
- Freshly prepared 80% ethanol in nuclease-free water
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- 15 ml Falcon tubes
- 1.5 ml Eppendorf DNA LoBind tubes
- 0.2 ml thin-walled PCR tubes
- Qubit™ Assay Tubes (Invitrogen, Q32856)
- Equipment
-
- PromethION Flow Cell Light Shield
- PromethION device
- Agilent Bioanalyzer (or equivalent)
- Hula mixer (gentle rotator mixer)
- Magnetic rack (e.g. Invitrogen DynaMag-2 Magnet, Cat # 12321D)
- Microfuge
- Vortex mixer
- Thermal cycler
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
- Ice bucket with ice
- Timer
- Qubit fluorometer (or equivalent for QC check)
-
For this protocol, you will need 10 ng amplified cDNA amplicons prepared using 10X Genomics Next GEM Single Cell 3' Kits (V3.1).
-
Custom-ordered oligo sequences
Order the following HPLC-purified oligos at 100 μM, and dilute to 10 μM in TE buffer for use in the Pre-pull-down step of the library prep.
Name Sequence [Btn]Fwd_3580_partial_read1_defined_for_3'_cDNA 5'-/5Biosg/CAGCACTTGCCTGTCGCTCTATCTTC
CTACACGACGCTCTTCCGATCT-3'Rev_PR2_partial_TSO_defined_for_3'_cDNA 5'-CAGCTTTCTGTTGGTGCTGATATTGCAAGCAGTGGTA
TCAACGCAGAG-3' -
AMPure XP beads
Extra AMPure XP Beads will be required for the first steps when preparing the cDNA amplicons. From the end-prep step, the AMPure XP Beads (AXP) from the Ligation Sequencing Kit V14 (SQK-LSK114) can be used.
-
Input DNA
How to QC your input DNA
It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Chemical contaminants
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.
-
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
-
Check your flow cell
We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within three months of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.
Flow cell Minimum number of active pores covered by warranty Flongle Flow Cell 50 MinION/GridION Flow Cell 800 PromethION Flow Cell 5000 -
PCR Expansion (EXP-PCA001) contents
Note: For this protocol, only PCR Primers (PRM) are required.
-
Ligation Sequencing Kit V14 (SQK-LSK114) contents
Note: We are in the process of reformatting our kits with single-use tubes into a bottle format.
Single-use tubes format:
Bottle format:
Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.
Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.