Direct RNA sequencing - sequence-specific (SQK-RNA002)

Version for device: MinION

1. Important This is a Legacy product

   This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.

2. Direct RNA Sequencing Kit features

   This kit is highly recommended for users who:

   • are exploring attributes of native RNA such as modified bases.
   • would like to remove RT or PCR bias.
   • have transcripts that are difficult to reverse transcribe.
3. Important Sequence-specific Direct RNA protocol

   This protocol is for sequencing RNA where the user wants to target a specific RNA sequence. In addition to the Direct RNA Sequencing Kit, you will need to order a custom oligo that is complementary to the 3' end of the target RNA sequence. This oligo replaces the Reverse Transcription Adapter (RTA) component of the kit.

   For sequencing poly(A)-tailed RNA, please refer to the standard Direct RNA Sequencing protocol.

4. Custom-ordered Reverse Transcription Adapter sequence

   The Reverse Transcription Adapter (RTA) supplied in the Direct RNA Sequencing kit is designed to ligate to any RNA with a poly(A)-tail. However, the RTA is a modular component and users can design their own RTA to target a specific RNA sequence (for example, to only ligate to 16S rRNA).

   To perform this type of sequence-targeted adapter ligation, order oligo A and a version of oligo B where the 10(dT) sequence at the 3' end is replaced with 10 bases complementary to the 3' end of your target RNA sequence (oligo sequences and RTA structure provided below). Both oligo A and oligo B are DNA.

   Anneal oligo A and oligo B 1:1 at 1.4 µM in buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl) by heating to 95º C for 2 minutes and letting them cool down slowly (0.1º C/sec). This directly replaces RTA in the protocol.

   

   Sequences:
   Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
   Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)

   Replace the 10(dT) sequence with 10 bases complementary to the 3' end of your target RNA sequence. All oligos should be HPLC purified.

5. Introduction to the sequence-specific Direct RNA Sequencing protocol

   This protocol describes how to carry out sequence-specific sequencing of native RNA using the Direct RNA Sequencing Kit (SQK-RNA002).

   Steps in the sequencing workflow:

   Prepare for your experiment

   You will need to:
   - Extract your RNA, and check its length, quantity and purity.
   The quality checks performed during the protocol are essential in ensuring experimental success.
   - Ensure you have your sequencing kit, the correct equipment and third-party reagents
   - Download the software for acquiring and analysing your data
   - Check your flow cell(s) to ensure it has enough pores for a good sequencing run

   Library preparation

   You will need to:
   - Synthesise the complementary strand of the RNA
   - Attach sequencing adapters supplied in the kit to the ends of the RNA-cDNA hybrid
   - Prime the flow cell, and load your RNA library into the flow cell

   

   Sequencing and analysis

   You will need to:
   - Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads

6. Important Unlike DNA, RNA is translocated through the nanopore in the 3'-5' direction. However, the basecalling algorithms automatically flip the data, and the reads are displayed 5'-3'.
7. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • Direct RNA Sequencing Kit (SQK-RNA002)
   • R9.4.1 (FLO-MIN106) flow cells
   • Flow Cell Wash Kit (EXP-WSH004)

1. For this protocol you will need 500 ng of total RNA in 9 µl.
2. Recommended RNA input

   Input recommendation is 500 ng of total RNA in 9 µl. For certain applications, lower input can be used but depending on the input, users may experience a drop in output.

   

   We recommend reading our Know How documents about RNA handling to ensure the highest success with this protocol. Available documents include:

   • Enrichment of polyadenylated RNA molecules
   • Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
   • RNA contaminants
   • RNA stability
   • RNA Integrity Number (RIN)
   • Input DNA/RNA QC
3. Direct RNA Sequencing Kit contents

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   RT Adapter	RTA	Blue	1	10
   RNA Adapter Mix	RMX	Green	1	45
   RNA Calibrant Strand	RCS	Yellow	1	25
   Wash Buffer	WSB	Orange	2	1,200
   Elution Buffer	ELB	Black	1	300
   RNA Running Buffer	RRB	Red	1	600

   Note: The RNA CS (RCS) is the calibration strand and contains the Enolase II from YHR174W, extracted from the yeast saccharomyces cerevisiae. The reference FASTA files for the yeast is available here.

4. Custom-ordered Reverse Transcription Adapter sequence

   The Reverse Transcription Adapter (RTA) supplied in the Direct RNA Sequencing kit is designed to ligate to any RNA with a poly(A)-tail. However, the RTA is a modular component and users can design their own RTA to target a specific RNA sequence (for example, to only ligate to 16S rRNA).

   To perform this type of sequence-targeted adapter ligation, order oligo A and a version of oligo B where the 10(dT) sequence at the 3' end is replaced with 10 bases complementary to the 3' end of your target RNA sequence (oligo sequences and RTA structure provided below). Both oligo A and oligo B are DNA.

   Anneal oligo A and oligo B 1:1 at 1.4 µM in buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl) by heating to 95º C for 2 minutes and letting them cool down slowly (0.1º C/sec). This directly replaces RTA in the protocol.

   

   Sequences:
   Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
   Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)

   Replace the 10(dT) sequence with 10 bases complementary to the 3' end of your target RNA sequence. All oligos should be HPLC purified.

5. Flow Cell Priming Kit contents (EXP-FLP002)

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   Flush Buffer	FB	Blue	6	1,170
   Flush Tether	FLT	Purple	1	200

1. MinION Mk1B IT requirements

   Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION Mk1B IT Requirements document.

2. MinION Mk1C IT requirements

   The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. Read more in the MinION Mk1C IT requirements document.

3. Software for nanopore sequencing

   MinKNOW

   The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

   For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

   EPI2ME (optional)

   The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

   For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

4. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

1. Prepare the RNA in nuclease-free water.
   • Transfer 500 ng of total RNA into a 1.5 ml Eppendorf DNA LoBind tube
   • Adjust the volume to 9 μl with nuclease-free water
   • Mix thoroughly by flicking the tube to avoid unwanted shearing
   • Spin down briefly in a microfuge

2. In a 0.2 ml thin-walled PCR tube, mix the reagents in the following order:

   Reagent	Volume
   NEBNext Quick Ligation Reaction Buffer	3.0 µl
   RNA	9.0 µl
   RNA CS (RCS), 110 nM	0.5 µl
   Custom-ordered Reverse Transcription Adapter	1.0 µl
   T4 DNA Ligase	1.5 µl
   Total	15 µl

3. Mix by pipetting and spin down.
4. Incubate the reaction for 10 minutes at room temperature.
5. Mix the following reagents together to make the reverse transcription master mix:

   Reagent	Volume
   Nuclease-free water	9.0 µl
   10 mM dNTPs	2.0 µl
   5x first-strand buffer	8.0 µl
   0.1 M DTT	4.0 µl
   Total	23.0 µl

6. Add the master mix to the 0.2 ml PCR tube containing the RT adapter-ligated RNA from the "RT Adapter ligation" step. Mix by pipetting.
7. Add 2 µl of SuperScript III Reverse Transcriptase to the reaction and mix by pipetting.
8. Place the tube in a thermal cycler and incubate at 50°C for 50 minutes, then 70°C for 10 minutes, and bring the sample to 4°C before proceeding to the next step.
9. Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
10. Resuspend the stock of Agencourt RNAClean XP beads by vortexing.
11. Add 72 µl of resuspended Agencourt RNAClean XP beads to the reverse transcription reaction and mix by pipetting.
12. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
13. Prepare 200 μl of fresh 70% ethanol in nuclease-free water.
14. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
15. Keep the tube on magnet, and wash the beads with 150 µl of freshly prepared 70% ethanol without disturbing the pellet as described below.
    1. Keeping the magnetic rack on the benchtop, rotate the bead-containing tube by 180°. Wait for the beads to migrate towards the magnet and form a pellet.
    2. Rotate the tube 180° again (back to the starting position), and wait for the beads to pellet.

16. Remove the 70% ethanol using a pipette and discard.
17. Spin down and place the tube back on the magnet until the eluate is clear and colourless. Keep the tube(s) on the magnet and pipette off any residual ethanol.
18. Remove the tube from the magnetic rack and resuspend the pellet in 20 µl nuclease-free water. Incubate for 5 minutes at room temperature.
19. Pellet the beads on a magnet until the eluate is clear and colourless.
20. Remove and retain 20 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
21. In the same 1.5 ml Eppendorf DNA LoBind tube, mix the reagents in the following order:

    Reagent	Volume
    NEBNext Quick Ligation Reaction Buffer	8.0 µl
    RNA Adapter (RMX)	6.0 µl
    Nuclease-free water	3.0 µl
    T4 DNA Ligase	3.0 µl
    Total (including all reagents)	40 µl

22. Mix by pipetting.
23. Incubate the reaction for 10 minutes at room temperature.
24. Resuspend the stock of Agencourt RNAClean XP beads by vortexing.
25. Add 16 µl of resuspended RNAClean XP beads to the adapter ligation reaction and mix by pipetting.
26. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
27. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
28. Add 150 μl of the Wash Buffer (WSB) to the beads. Close the tube lid and resuspend the beads by flicking the tube. Return the tube to the magnetic rack, allow the beads to pellet for 5 minutes and pipette off the supernatant when clear and colourless.
29. Repeat the previous step.
30. Important Agitating the beads results in a more efficient removal of free adapter, compared to adding the wash buffer and immediately aspirating.
31. Remove the tube from the magnetic rack and resuspend pellet in 21 µl Elution Buffer by the gently flicking the tube. Incubate for 10 minutes at room temperature.
32. Pellet the beads on a magnet until the eluate is clear and colourless.
33. Remove and retain 21 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
34. Quantify 1 µl of reverse-transcribed and adapted RNA using the Qubit fluorometer DNA HS assay - recovery aim ~20 ng.

    If you have omitted the reverse transcription step, please use the Qubit RNA HS Assay Kit instead. However, please note that the kit will measure all RNA present, including any non-adapted RNA that has been carried through in the RNAClean XP bead clean-up. The reported quantity of RNA may therefore not fully represent the amount of sequenceable RNA.

35. End of Step The reverse-transcribed and adapted RNA is now ready for loading into the flow cell.

1. Thaw the RNA Running Buffer (RRB), Flush Tether (FLT) and one tube of Flush Buffer (FB) at room temperature.
2. Mix the RNA Running Buffer (RRB), Flush Buffer (FB) and Flush Tether (FLT) tubes thoroughly by vortexing and spin down at room temperature.
3. To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing at room temperature.
4. Open the MinION device lid and slide the flow cell under the clip.

   Press down firmly on the flow cell to ensure correct thermal and electrical contact.

   

   

5. Optional Action

   Complete a flow cell check to assess the number of pores available before loading the library.

   This step can be omitted if the flow cell has been checked previously.

   See the flow cell check instructions in the MinKNOW protocol for more information.

6. Slide the priming port cover clockwise to open the priming port.

   

7. Important Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
8. After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
   1. Set a P1000 pipette to 200 µl
   2. Insert the tip into the priming port
   3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
      

   Note: Visually check that there is continuous buffer from the priming port across the sensor array.

   

9. Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

   

10. Important Thoroughly mix the contents of the RRB tube by vortexing or pipetting, and spin down briefly.
11. Take 20 µl of the prepared RNA library and mix it with 17.5 µl of nuclease-free water.
12. In a new tube, prepare the library for loading as follows:

    Reagent	Volume per flow cell
    RNA Running Buffer (RRB)	37.5 µl
    RNA library in nuclease-free water	37.5 µl
    Total	75 µl

13. Complete the flow cell priming:
    1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
    2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

    

    

14. Mix the prepared library gently by pipetting up and down just prior to loading.
15. Add 75 μl of sample to the Flow Cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

    

16. Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

    

    

17. Important Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

    We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

18. Place the light shield onto the flow cell, as follows:

    1. Carefully place the leading edge of the light shield against the clip.
       Note: Do not force the light shield underneath the clip.

    2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

    

19. Caution The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
20. End of Step Close the device lid and set up a sequencing run on MinKNOW.

1. How to start sequencing

   Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

   MinKNOW can be used and set up to sequence in multiple ways:

   • On a computer either directly or remotely connected to a sequencing device.
   • Directly on a GridION, MinION Mk1C or PromethION 24/48 sequencing device.

   For more information on using MinKNOW on a sequencing device, please see the device user manuals:

   • MinION Mk1B user manual
   • MinION Mk1C user manual
   • GridION user manual

   ---

   To start a sequencing run on MinKNOW:

   1. Navigate to the start page and click Start sequencing.

   2. Fill in your experiment details, such as name and flow cell position and sample ID.

   3. Select the sequencing kit used in the library preparation on the Kit page.

   4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

   Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

   5. Click Start to initiate the sequencing run.

2. Data analysis after sequencing

   After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.

   After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

   In the Downstream analysis section, we outline further options for analysing your data.

1. After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at 2-8°C.

   The Flow Cell Wash Kit protocol is available on the Nanopore Community.

2. Tip We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
3. Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.

   Instructions for returning flow cells can be found here.

   Note: All flow cells must be flushed with deionised water before returning the product.

4. Important If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

1. Post-basecalling analysis

   There are several options for further analysing your basecalled data:

   1. EPI2ME workflows

   For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

   2. Research analysis tools

   Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

   3. Community-developed analysis tools

   If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation).	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.

11. Guppy – no input .fast5 was found or basecalled

    Observation	Possible cause	Comments and actions
    No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
    No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

12. Guppy – no Pass or Fail folders were generated after basecalling

    Observation	Possible cause	Comments and actions
    No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

13. Guppy – unusually slow processing on a GPU computer

    Observation	Possible cause	Comments and actions
    Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.