Version for device: MinION
This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.
Use this protocol if you:
This protocol describes how to carry out exome sequencing using the Ligation Sequencing Kit (SQK-LSK109) and the Agilent SureSelect method.
Steps in the sequencing workflow:
Prepare for your experiment
You will need to:
- Ensure you have your sequencing kit, the correct equipment and third-party reagents
- Download the software for acquiring and analysing your data
- Check your flow cell to ensure it has enough pores for a good sequencing run
Library preparation
You will need to:
- Fragment your DNA
- Ligate PCR adapters to the DNA ends and amplify the fragments
- Hybridise the DNA to probes provided in the Agilent SureSelect Exome kit, and perform a pulldown
- Elute and amplify the pulled-down fragments
- Prepare the DNA ends for adapter attachment
- Attach sequencing adapters supplied in the kit to the DNA ends
- Prime the flow cell, and load your DNA library into the flow cell
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
- Start the EPI2ME software and select a workflow for Human Exome mapping, or use minimap2 to align the reads to the human reference genome.
This protocol should only be used in combination with:
It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.
Please order these sequences at 10 μM from IDT:
Forward primer: 5’ CAATTCGGTCTCCAGTGACTTGCCTGTCGCTCTATCTTC 3’
Reverse Primer: 5’ CAATTCGGTCTCCCACTTTTCTGTTGGTGCTGATATTGC 3’
Name | Acronym | Cap colour | No. of vials | Fill volume per vial (µl) |
---|---|---|---|---|
DNA CS | DCS | Yellow | 1 | 50 |
Adapter Mix | AMX | Green | 1 | 40 |
Ligation Buffer | LNB | Clear | 1 | 200 |
L Fragment Buffer | LFB | White cap, orange stripe on label | 2 | 1,800 |
S Fragment Buffer | SFB | Grey | 2 | 1,800 |
Sequencing Buffer | SQB | Red | 2 | 300 |
Elution Buffer | EB | Black | 1 | 200 |
Loading Beads | LB | Pink | 1 | 360 |
Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
---|---|---|---|---|
Flush Buffer | FB | Blue | 6 | 1,170 |
Flush Tether | FLT | Purple | 1 | 200 |
Computer requirements and software
Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1B IT requirements document.
The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. For more information refer to the MinION Mk1C IT requirements document.
Sequencing on a MinION Mk1D requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1D IT requirements document.
The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.
For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.
The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.
For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.
We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.
Flow cell | Minimum number of active pores covered by warranty |
---|---|
Flongle Flow Cell | 50 |
MinION/GridION Flow Cell | 800 |
PromethION Flow Cell | 5000 |
Reagent | Volume |
---|---|
DNA | 16 µl |
10x Fragmentase Reaction Buffer v2 | 2 µl |
Total | 18 µl |
Samples may fragment at different rates; 28 mins has shown to be the optimum time for NA12878 DNA extracted with the QIAGEN Genomic-tip. Users may wish to titrate fragmentation times of 25–32 mins if the fragmented yield is low.
Note: Do not discard the supernatant.
The fragment length distribution is expected to be similar to the trace below:
End-prep
Between each addition, pipette mix 10-20 times.
Reagent | Volume |
---|---|
Fragmented DNA | 20 µl |
Ultra II End-prep reaction buffer | 7 µl |
Ultra II End-prep enzyme mix | 3 µl |
Nuclease-free water | 30 µl |
Total | 60 µl |
Reagent | Volume |
---|---|
End-prepped DNA | 30 µl |
PCR Adapters (PCA) | 20 µl |
NEB Blunt/TA Ligase Master Mix | 50 µl |
Total | 100 µl |
End-prep cleanup demo
Reagent | Volume |
---|---|
LongAmp Taq 2X Master Mix | 50 µl |
PRM Adapters (10 μM) | 2 µl |
Template DNA | 48 µl |
Total | 100 µl |
Cycle step | Temperature | Time | No. of cycles |
---|---|---|---|
Initial denaturation | 95 °C | 3 mins | 1 |
Denaturation | 98 °C | 20 secs | 6 (b) |
Annealing | 62 °C (a) | 15 secs (a) | 6 (b) |
Extension | 65 °C (c) | 3 mins | 6 (b) |
Final extension | 65 °C | 3 mins | 1 |
Hold | 4 °C | ∞ |
a. This is specific to the Oxford Nanopore primer and should be maintained
b. Adjust accordingly if input quantities are altered
c. This temperature is determined by the type of polymerase that is being used (given here for LongAmp Taq polymerase)
Reagent | Volume |
---|---|
DNA library | 300–1000 ng |
Cot-1 DNA | 5 µg |
Blocking oligo top | 1 µl |
Poke one or more holes in the lid with a narrow gauge needle. You can also break off the cap, cover with parafilm, and poke a hole in the parafilm.
Stage | Temperature | Time |
---|---|---|
Step 1 | 95°C | 5 min |
Step 2 | 65°C | 5 min |
Step 3 | 65°C | Hold |
Reagent | Volume for 1 reaction |
---|---|
SureSelect Hyb 1 (orange cap or bottle) | 6.63 µl |
SureSelect Hyb 2 (red cap) | 0.27 µl |
SureSelect Hyb 3 (yellow cap or bottle) | 2.65 µl |
SureSelect Hyb 4 (black cap or bottle) | 3.45 µl |
Total | 13 µl |
In the event of precipitation, warm the Hybridisation Buffer at 65°C for 5 minutes.
Otherwise, keep buffer at room temperature until it is used for the Hybridisation mix.
RNase block dilution (parts RNase block:water) | Volume of diluted RNase block |
---|---|
25% (1:3) | 2 μl |
Reagent | Volume for 1 reaction |
---|---|
Hybridisation buffer mixture | 13 µl |
25% RNase Block solution | 2 µl |
Capture library (red cap) ≥3 Mb | 5 µl |
Total | 20 µl |
We do not recommend pausing your library prep at this stage by storing your sample at 4°C overnight.
Please order these sequences at 10 μM from IDT:
Forward primer: 5’ CAATTCGGTCTCCAGTGACTTGCCTGTCGCTCTATCTTC 3’
Reverse Primer: 5’ CAATTCGGTCTCCCACTTTTCTGTTGGTGCTGATATTGC 3’
Reagent | Volume |
---|---|
LongAmp Taq 2x Master Mix | 50 µl |
Custom primer mix | 2 µl |
Template DNA | 48 µl |
Total | 100 µl |
Cycle step | Temperature | Time | No. of cycles |
---|---|---|---|
Initial denaturation | 95°C | 3 mins | 1 |
Denaturation | 98°C | 20 secs | 14 (b) |
Annealing | 62°C (a) | 15 secs (a) | 14 (b) |
Extension | 65°C (c) | 3 mins | 14 (b) |
Final extension | 65°C | 3 mins | 1 |
Hold | 4°C | ∞ |
a. This is specific to the primer mix and should be maintained
b. Adjust accordingly if input quantities are altered
c. This temperature is determined by the type of polymerase that is being used (given here for LongAmp Taq polymerase)
The fragment length distribution is expected to be similar to the trace below:
Mix the following reagents in a 1.5 ml Eppendorf DNA LoBind tube:
Reagent | Volume |
---|---|
DNA | 48 µl |
Ultra II End-prep reaction buffer | 7 µl |
Ultra II End-prep enzyme mix | 3 µl |
Nuclease-free water | 2 µl |
Total | 60 µl |
Adapter ligation and clean-up
Reagent | Volume |
---|---|
DNA sample from the previous step | 30 µl |
Nuclease-free water | 30 µl |
Ligation Buffer (LNB) | 25 µl |
NEBNext Quick T4 DNA Ligase | 10 µl |
Adapter Mix (AMX) | 5 µl |
Total | 100 µl |
Dispose of the pelleted beads
We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short term storage or repeated use, for example, reloading flow cells between washes.
For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.
For further information, please refer to the DNA library stability Know-How document.
Additional buffer for doing this can be found in the Sequencing Auxiliary Vials expansion (EXP-AUX001), available to purchase separately. This expansion also contains additional vials of Sequencing Buffer (SQB) and Loading Beads (LB), required for loading the libraries onto flow cells.
Priming and loading the SpotON flow cell
Press down firmly on the flow cell to ensure correct thermal and electrical contact.
This step can be omitted if the flow cell has been checked previously.
See the flow cell check instructions in the MinKNOW protocol for more information.
Note: Visually check that there is continuous buffer from the priming port across the sensor array.
Reagent | Volume per flow cell |
---|---|
Sequencing Buffer (SQB) | 37.5 µl |
Loading Beads (LB), mixed immediately before use | 25.5 µl |
DNA library | 12 µl |
Total | 75 µl |
Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer (SQB) and Loading Beads (LB) because the fuel in the buffer will start to be consumed by the adapter.
We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.
Carefully place the leading edge of the light shield against the clip.
Note: Do not force the light shield underneath the clip.
Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.
Monitor the experimental parameters in MinKNOW during your sequencing experiment. As the sample is enriched for shorter fragments, there is a higher number of motor enzymes turning over fuel than when sequencing longer fragments. This may result in a speed drop-off during the run.
If the sequencing speed falls below the green bar in MinKNOW, follow the instructions in Refuelling your flow cell in the MinKNOW protocol.
If you see a reducing number of active pores during your experiment, please consider washing your flow cell using the Flow Cell Wash Kit, and reload another 50 fmol of library.
Data acquisition and basecalling
For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.
The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:
Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.
Follow the instructions in the MinION Mk1B user manual or the MinION Mk1D user manual.
Follow the instructions in the MinION Mk1C user manual.
Follow the instructions in the GridION user manual.
Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.
Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.
Downstream analysis
Human Exome is an EPI2ME™ workflow for aligning basecalled reads to a set of reference sequences from Ensembl using the minimap2 aligner, covering the entire human exome. Alignments are performed against full gene sequences, including exons and introns, but currently not against flanking regions. The reference sequences are taken from the feature strand of the most recent human genome assembly, GRCh38.
The experiment report gives details on sequence length, accuracy, quality score and the amount of data generated during the experiment. It is possible to align to a number of human reference genes, and view more details about alignment coverage and accuracy.
For more information, please refer to the Workflows section in the EPI2ME protocol.
Expected mean target coverage from one MinION Mk 1B flow cell:
Aligned read length:
For more in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials, which are available in the Bioinformatics resource section of the Community. The tutorials take the user through installing and running pre-built analysis pipelines, which generate a report with the results. The tutorials are aimed at biologists who would like to analyse data without the help of a dedicated bioinformatician, and who are comfortable using the command line.
Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.
If a data analysis method for your research question is not provided in any of the resources above, we recommend the Community-developed data analysis tool library. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.
Flow cell reuse and returns
The Flow Cell Wash Kit protocol is available on the Nanopore Community.
Instructions for returning flow cells can be found here.
Issues during DNA/RNA extraction and library preparation
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Observation | Possible cause | Comments and actions |
---|---|---|
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) | The DNA extraction method does not provide the required purity | The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step. |
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. |
RNA has a shorter than expected fragment length | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA. |
Observation | Possible cause | Comments and actions |
---|---|---|
Low recovery | DNA loss due to a lower than intended AMPure beads-to-sample ratio | 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up. |
Low recovery | DNA fragments are shorter than expected | The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. ![]() |
Low recovery after end-prep | The wash step used ethanol <70% | DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage. |
Issues during the sequencing run
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Observation | Possible cause | Comments and actions |
---|---|---|
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | An air bubble was introduced into the nanopore array | After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video. |
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | The flow cell is not correctly inserted into the device | Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION). |
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | Contaminations in the library damaged or blocked the pores | The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Observation | Possible cause | Comments and actions |
---|---|---|
MinKNOW shows "Script failed" | Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance. |
Observation | Possible cause | Comments and actions |
---|---|---|
Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol" |
Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA | Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents. |
Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation | Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters. |
Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming. |
Observation | Possible cause | Comments and actions |
---|---|---|
Shorter than expected read length | Unwanted fragmentation of DNA sample | Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. ![]() 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient. |
Observation | Possible cause | Comments and actions |
---|---|---|
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) ![]() |
Contaminants are present in the sample | Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems. |
Observation | Possible cause | Comments and actions |
---|---|---|
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) | Air bubbles have been introduced into the flow cell | Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice |
Large proportion of inactive/unavailable pores | Certain compounds co-purified with DNA | Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit. |
Large proportion of inactive/unavailable pores | Contaminants are present in the sample | The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Observation | Possible cause | Comments and actions |
---|---|---|
Reduction in sequencing speed and q-score later into the run | For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). | Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell. |
Observation | Possible cause | Comments and actions |
---|---|---|
Temperature fluctuation | The flow cell has lost contact with the device | Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services. |
Observation | Possible cause | Comments and actions |
---|---|---|
MinKNOW shows "Failed to reach target temperature" | The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) | MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control. |
Observation | Possible cause | Comments and actions |
---|---|---|
No input .fast5 was found or basecalled | input_path did not point to the .fast5 file location | The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH. |
No input .fast5 was found or basecalled | The .fast5 files were in a subfolder at the input_path location | To allow Guppy to look into subfolders, add the --recursive flag to the command |
Observation | Possible cause | Comments and actions |
---|---|---|
No Pass or Fail folders were generated after basecalling | The --qscore_filtering flag was not included in the command | The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders. |
Observation | Possible cause | Comments and actions |
---|---|---|
Unusually slow processing on a GPU computer | The --device flag wasn't included in the command | The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command. |
Purchase a MinION Starter Pack from Avantor to get full community access and benefit from:
Already have a Nanopore Community account?
Log in hereRequest a call with our experts for detailed advice on implementing nanopore sequencing.
Request a callVisit our microbial sequencing spotlight page on vwr.com.
Microbial sequencingWe use cookies and similar technologies on our websites to help provide you with the best possible online experience.
By using our sites and apps, you agree that we may store and access cookies and similar technologies on your device.