PCR tiling of SARS-CoV-2 virus - rapid barcoding (SQK-RBK110.96)

Version for device: MinION

1. Important This protocol is a work in progress and some details are expected to change over time. Please make sure you always use the most recent version of the protocol.

   This protocol is the first iteration of the PCR tiling with rapid barcoding protocol Oxford Nanopore Technologies released using third party reagents. This protocol uses the Rapid Barcoding Kit 96 (SQK-RBK110.96) for barcoding and library preparation and the third party reagents are not included in the kit.

   For the most up to date and optimised protocol, we recommend using the PCR tiling of SARS-CoV-2 virus with rapid barcoding and Midnight RT PCR Expansion (SQK-RBK110.96 and EXP-MRT001) protocol.

   Below, we have highlighted the differences between the protocols.

   Step	PCR tiling of SARS-CoV-2 virus with rapid barcoding (SQK-RBK110.96) Version: pctr_9125_v110_reve_24mar2021	PCR tiling of SARS-CoV-2 virus with rapid barcoding and Midnight RT PCR Expansion (SQK-RBK110.96 and EXP-MRT001) Version: mrt_9127_v110_revh_14jul2021
   Reverse transcription	LunaScript: 4 µl Sample: 16 µl	LunaScript: 2 µl Sample: 8 µl
   PCR	IDT lab-ready midnight primers or stock primers PCR mastermix: Nuclease-free water: 9.89 µl Primer pool A/B (100 µM): 0.11 µl Q5® Hot Start HF 2x Master Mix: 12.5 µl Total: 22.5 µl per sample RT reaction: 2.5 µl per primer pool	Lab-ready Midnight primers from the kit PCR mastermix: Nuclease-free water : 3.7 µl Midnight Primer Pool A/B (MP A/MP B) (100 µM): 0.05 µl Q5 HS Master Mix (Q5): 6.25 µl Total: 10 µl RT reaction: 2.5 µl per primer pool
   Addition of rapid barcodes	25 µl pool B transferred into pool A	12.5 µl pool B transferred into pool A
   Pooling samples and clean-up	Full volume of pooled samples taken forward for SPRI clean Washed in 1.5 ml of 80% ethanol Eluate retained: 30 µl 600-800 ng library in 11 µl EB	Half volume of pooled samples taken forward for SPRI clean Washed in 1 ml of 80% ethanol Eluate retained: 15 µl 800 ng library in 11 µl EB

2. Introduction to the protocol

   To enable support for the rapidly expanding user requests, the team at Oxford Nanopore Technologies have put together an updated workflow based on the ARTIC Network protocols and analysis methods. The protocol uses Oxford Nanopore Technologies' Rapid Barcoding Kit 96 (SQK-RBK110.96) for barcoding and library preparation.

   While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the members of the ARTIC network who have been behind the development of these methods.

   This protocol is similar to the ARTIC amplicon sequencing protocol for MinION for SARS-CoV-2 v3 (LoCost) by Josh Quick. The protocol generates 1200 bp amplicons in a tiled fashion across the whole SARS-CoV-2 genome. Some example data is shown in the Downstream analysis and expected results section, this is generated using the Twist Synthetic SARS-CoV-2 RNA controls to show what would be expected when running this protocol with SARS-CoV-2 samples.

   To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA for use with the Rapid Barcoding Kit 96, primers were designed by Freed et al., 2020 using Primal Scheme. These primers are designed to generate 1.2 kb amplicons that overlap by approximately 20 bp. Primer sequences can be found here.

   Primers can be ordered pre-pooled directly from IDT under the name SARS-Cov2-Midnight-1200, 500 rxn at a concentration of 100 μM per pool.

   Steps in the sequencing workflow:

   Prepare for your experiment
   you will need to:

   • Extract your RNA
   • Ensure you have your sequencing kit, the correct equipment and third-party reagents
   • Download the software for acquiring and analysing your data
   • Check your flow cell to ensure it has enough pores for a good sequencing run

   Prepare your library
   You will need to:

   • Reverse transcribe your RNA samples with random hexamers
   • Amplify the samples by tiled PCR using separate primer pools
   • Combine the primer pools
   • Attach rapid barcodes supplied in the kit to the DNA ends, pool the samples and SPRI purify
   • Prime the flow cell and load your DNA library into the flow cell

   

   Sequencing and analysis
   You will need to:

   • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
3. Before starting

   This protocol outlines how to carry out PCR tiling of SARS-CoV-2 viral RNA samples on a 96-well plate using the Rapid Barcoding Kit 96 (SQK-RBK110.96).

   When processing multiple samples at once, we recommend making master mixes with an additional 10% of the volume. We also recommend using pre- and post-PCR hoods when handling master mixes and samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.

   To minimise the chance of pipetting errors when preparing primer mixes, we recommend ordering the tiling primers from IDT in a lab-ready format at 100 µM.

4. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • Rapid Barcoding Kit 96 (SQK-RBK110.96)
   • R9.4.1 flow cells (FLO-MIN106)
   • Flow Cell Wash Kit (EXP-WSH004)

1. For this protocol, you will need your extracted RNA in 16 µl 10 mM Tris-HCl, pH 8.0.
2. Rapid Barcoding Kit 96 (SQK-RBK110.96) contents

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
   Rapid Barcode plate	RB96	-	3 plates	8 µl per well
   AMPure XP Beads	AXP	Brown	3	1,200
   Sequencing Buffer II	SBII	Red	1	500
   Rapid Adapter F	RAP-F	Green	1	25
   Elution Buffer	EB	Black	1	500
   Loading Beads II	LBII	Pink	1	360
   Loading Solution	LS	White cap, pink label	1	400
   Flush Tether	FLT	Purple	1	400
   Flush Buffer	FB	White	1 bottle	15,500

   This product contains AMPure XP reagent manufactured by Beckman Coulter, Inc.

3. Rapid barcode sequences

   Component	Sequence
   RB01	AAGAAAGTTGTCGGTGTCTTTGTG
   RB02	TCGATTCCGTTTGTAGTCGTCTGT
   RB03	GAGTCTTGTGTCCCAGTTACCAGG
   RB04	TTCGGATTCTATCGTGTTTCCCTA
   RB05	CTTGTCCAGGGTTTGTGTAACCTT
   RB06	TTCTCGCAAAGGCAGAAAGTAGTC
   RB07	GTGTTACCGTGGGAATGAATCCTT
   RB08	TTCAGGGAACAAACCAAGTTACGT
   RB09	AACTAGGCACAGCGAGTCTTGGTT
   RB10	AAGCGTTGAAACCTTTGTCCTCTC
   RB11	GTTTCATCTATCGGAGGGAATGGA
   RB12	CAGGTAGAAAGAAGCAGAATCGGA
   RB13	AGAACGACTTCCATACTCGTGTGA
   RB14	AACGAGTCTCTTGGGACCCATAGA
   RB15	AGGTCTACCTCGCTAACACCACTG
   RB16	CGTCAACTGACAGTGGTTCGTACT
   RB17	ACCCTCCAGGAAAGTACCTCTGAT
   RB18	CCAAACCCAACAACCTAGATAGGC
   RB19	GTTCCTCGTGCAGTGTCAAGAGAT
   RB20	TTGCGTCCTGTTACGAGAACTCAT
   RB21	GAGCCTCTCATTGTCCGTTCTCTA
   RB22	ACCACTGCCATGTATCAAAGTACG
   RB23	CTTACTACCCAGTGAACCTCCTCG
   RB24	GCATAGTTCTGCATGATGGGTTAG
   RB25	GTAAGTTGGGTATGCAACGCAATG
   RB26	CATACAGCGACTACGCATTCTCAT
   RB27	CGACGGTTAGATTCACCTCTTACA
   RB28	TGAAACCTAAGAAGGCACCGTATC
   RB29	CTAGACACCTTGGGTTGACAGACC
   RB30	TCAGTGAGGATCTACTTCGACCCA
   RB31	TGCGTACAGCAATCAGTTACATTG
   RB32	CCAGTAGAAGTCCGACAACGTCAT
   RB33	CAGACTTGGTACGGTTGGGTAACT
   RB34	GGACGAAGAACTCAAGTCAAAGGC
   RB35	CTACTTACGAAGCTGAGGGACTGC
   RB36	ATGTCCCAGTTAGAGGAGGAAACA
   RB37	GCTTGCGATTGATGCTTAGTATCA
   RB38	ACCACAGGAGGACGATACAGAGAA
   RB39	CCACAGTGTCAACTAGAGCCTCTC
   RB40	TAGTTTGGATGACCAAGGATAGCC
   RB41	GGAGTTCGTCCAGAGAAGTACACG
   RB42	CTACGTGTAAGGCATACCTGCCAG
   RB43	CTTTCGTTGTTGACTCGACGGTAG
   RB44	AGTAGAAAGGGTTCCTTCCCACTC
   RB45	GATCCAACAGAGATGCCTTCAGTG
   RB46	GCTGTGTTCCACTTCATTCTCCTG
   RB47	GTGCAACTTTCCCACAGGTAGTTC
   RB48	CATCTGGAACGTGGTACACCTGTA
   RB49	ACTGGTGCAGCTTTGAACATCTAG
   RB50	ATGGACTTTGGTAACTTCCTGCGT
   RB51	GTTGAATGAGCCTACTGGGTCCTC
   RB52	TGAGAGACAAGATTGTTCGTGGAC
   RB53	AGATTCAGACCGTCTCATGCAAAG
   RB54	CAAGAGCTTTGACTAAGGAGCATG
   RB55	TGGAAGATGAGACCCTGATCTACG
   RB56	TCACTACTCAACAGGTGGCATGAA
   RB57	GCTAGGTCAATCTCCTTCGGAAGT
   RB58	CAGGTTACTCCTCCGTGAGTCTGA
   RB59	TCAATCAAGAAGGGAAAGCAAGGT
   RB60	CATGTTCAACCAAGGCTTCTATGG
   RB61	AGAGGGTACTATGTGCCTCAGCAC
   RB62	CACCCACACTTACTTCAGGACGTA
   RB63	TTCTGAAGTTCCTGGGTCTTGAAC
   RB64	GACAGACACCGTTCATCGACTTTC
   RB65	TTCTCAGTCTTCCTCCAGACAAGG
   RB66	CCGATCCTTGTGGCTTCTAACTTC
   RB67	GTTTGTCATACTCGTGTGCTCACC
   RB68	GAATCTAAGCAAACACGAAGGTGG
   RB69	TACAGTCCGAGCCTCATGTGATCT
   RB70	ACCGAGATCCTACGAATGGAGTGT
   RB71	CCTGGGAGCATCAGGTAGTAACAG
   RB72	TAGCTGACTGTCTTCCATACCGAC
   RB73	AAGAAACAGGATGACAGAACCCTC
   RB74	TACAAGCATCCCAACACTTCCACT
   RB75	GACCATTGTGATGAACCCTGTTGT
   RB76	ATGCTTGTTACATCAACCCTGGAC
   RB77	CGACCTGTTTCTCAGGGATACAAC
   RB78	AACAACCGAACCTTTGAATCAGAA
   RB79	TCTCGGAGATAGTTCTCACTGCTG
   RB80	CGGATGAACATAGGATAGCGATTC
   RB81	CCTCATCTTGTGAAGTTGTTTCGG
   RB82	ACGGTATGTCGAGTTCCAGGACTA
   RB83	TGGCTTGATCTAGGTAAGGTCGAA
   RB84	GTAGTGGACCTAGAACCTGTGCCA
   RB85	AACGGAGGAGTTAGTTGGATGATC
   RB86	AGGTGATCCCAACAAGCGTAAGTA
   RB87	TACATGCTCCTGTTGTTAGGGAGG
   RB88	TCTTCTACTACCGATCCGAAGCAG
   RB89	ACAGCATCAATGTTTGGCTAGTTG
   RB90	GATGTAGAGGGTACGGTTTGAGGC
   RB91	GGCTCCATAGGAACTCACGCTACT
   RB92	TTGTGAGTGGAAAGATACAGGACC
   RB93	AGTTTCCATCACTTCAGACTTGGG
   RB94	GATTGTCCTCAAACTGCCACCTAC
   RB95	CCTGTCTGGAAGAAGAATGGACTT
   RB96	CTGAACGGTCATAGAGTCCACCAT

1. MinION Mk1B IT requirements

   Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1B IT requirements document.

2. MinION Mk1C IT requirements

   The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. For more information refer to the MinION Mk1C IT requirements document.

3. MinION Mk1D IT requirements

   Sequencing on a MinION Mk1D requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1D IT requirements document.

4. Software for nanopore sequencing

   MinKNOW

   The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

   For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

   EPI2ME (optional)

   The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

   For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

5. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

1. Important Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation, which may affect sensitivity.
2. In a clean pre-PCR hood, using a stepper pipette, or a multichannel pipette, add 4 µl of LunaScript™ RT SuperMix to a fresh 96-well plate (RT Plate).

   Depending on the number of samples, fill each well per column as follows:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	1-3	1-6	1-12

   

3. To each well containing LunaScript reagent of the RT plate, add 16 µl of sample and gently mix by pipetting. If adding less than 16 µl, make up the rest to the volume with nuclease-free water.

   Example for X48 samples:
   

4. Important We recommend having a single negative control for every plate of samples and a standard curve of positive controls.
5. Seal the RT plate and spin down. Return the plate to ice.
6. Preheat the thermal cycler to 25°C.
7. Incubate the samples in the thermal cycler using the following program:

   Step	Temperature	Time	Cycles
   Primer annealing	25°C	2 min	1
   cDNA synthesis	55°C	10 min	1
   Heat inactivation	95°C	1 min	1
   Hold	4°C	∞

8. End of Step While the reverse transcription reaction is running, prepare the primer pools as described in the next section.

1. Primer design

   To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA, primers were designed by Freed et al., 2020 using Primal Scheme. These primers are designed to generate 1200 bp amplicons that overlap by approximately 20 bp. These primer sequences can be found here.

2. Important We recommend ordering the required primers from IDT in a lab-ready format at 100 µM. However, if primers have been ordered lyophilised, they should be resuspended in water or low-EDTA TE buffer to a final concentration of 100 µM.
3. Important We recommend handling the primer stocks and derivatives in a clean template-free PCR hood.
4. In the pre-PCR hood, prepare the following master mixes in Eppendorf DNA LoBind tubes and mix thoroughly as follows:

   Volume per sample:

   Reagent	Pool A	Pool B
   RNase-free water	9.89 µl	9.89 µl
   Primer pool A (100 µM)	0.11 µl	-
   Primer pool B (100 µM)	-	0.11 µl
   Q5® Hot Start HF 2x Master Mix	12.5 µl	12.5 µl
   Total	22.5 µl	22.5 µl

   For x24 samples:

   Reagent	Pool A	Pool B
   RNase-free water	269.7 µl	269.7 µl
   Primer pool A (100 µM)	3 µl	-
   Primer pool B (100 µM)	-	3 µl
   Q5® Hot Start HF 2x Master Mix	341 µl	341 µl
   Total	613.7 µl	613.7 µl

   For x48 samples:

   Reagent	Pool A	Pool B
   RNase-free water	548.5 µl	548.5 µl
   Primer pool A (100 µM)	6.1 µl	-
   Primer pool B (100 µM)	-	6.1 µl
   Q5® Hot Start HF 2x Master Mix	693.2 µl	693.2 µl
   Total	1247.8 µl	1247.8 µl

   For x96 samples:

   Reagent	Pool A	Pool B
   RNase-free water	1088 µl	1088 µl
   Primer pool A (100 µM)	12.1 µl	-
   Primer pool B (100 µM)	-	12.1 µl
   Q5® Hot Start HF 2x Master Mix	1375 µl	1375 µl
   Total	2475.1 µl	2475.1 µl

5. Using a stepper pipette or a multichannel pipette, aliquot 22.5 µl of Pool A and Pool B into a clean 96-well plate(s) as follows:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	Pool A: 1-3 Pool B: 4-6	Pool A: 1-6 Pool B: 7-12	Pool A: 1-12 Pool B: 1-12

   Note: For x96 samples, Pool A is a separate plate to Pool B.

   

6. Using a multichannel pipette, transfer 2.5 µl of each RT reaction from the RT plate to the corresponding well for both Pool A and Pool B of the PCR plate(s). Mix by pipetting the contents of each well up and down.

   There should be two PCR reactions per sample.

   Example for X48 samples:
   

7. Important Carry forward the negative control from the reverse transcription reaction to monitor cross-contamination events.

   We recommend having a single negative for every plate of samples and a standard curve of positive controls.

8. Seal the plate(s) and spin down briefly.
9. Incubate using the following program, with the heated lid set to 105°C:

   Step	Temperature	Time	Cycles
   Initial denaturation	98°C	30 sec	1
   Denaturation Annealing and extension	98°C 65°C	15 sec 5 min	35
   Hold	4°C	∞

10. End of Step When PCR reaches 30-35 cycles, assemble the Rapid Barcode reaction plate as described in the next section.

1. Spin down the Rapid Barcode Plate and PCR reactions prior to opening to collect material in the bottom of the wells.
2. Using a stepper pipette or a multichannel pipette, add 2.5 μl of nuclease-free water to the wells in a clean 96-well plate (Barcode Attachment Plate).

   Depending on the number of samples, aliquot into each well of the columns as follows:

   Plate location	x24 samples	x48 samples	x96 samples
   Columns	1-3	1-6	1-12

   

3. Using a multichannel pipette, transfer 25 µl of each well of PCR Pool B to the corresponding well of PCR Pool A and mix by pipetting.

   Depending on the number of samples, Pool B columns will correspond to different Pool A columns.

   No. of samples	Pool B column	Corresponding Pool A column
   X24	4 5 6	1 2 3
   X48	7 8 9 10 11 12	1 2 3 4 5 6
   X96	1 2 3 4 5 6 7 8 9 10 11 12	1 2 3 4 5 6 7 8 9 10 11 12

   Example for X48 samples:
   

4. Using a multichannel pipette, transfer 5 µl from each well of PCR Pool A (now containing pooled PCR products) to the corresponding well of the Barcode Attachment Plate and mix by pipetting.

   Depending on the number of samples, PCR Pool A will be in each well of the following columns:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	1-3	1-6	1-12

   Example for X48 samples:
   

5. Using a multichannel pipette, transfer 2.5 μl from the Rapid Barcode Plate to the corresponding well of the Barcode Attachment Plate, taking care not to cross-contaminate different wells. Mix by pipetting.

   Depending on the number of samples, aliquot into each well of the columns as follows:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	1-3	1-6	1-12

   Example for X48 samples:
   

6. Seal the Barcode Attachment Plate and spin down.
7. Incubate the plate in a thermal cycler at 30°C for 2 minutes and then at 80°C for 2 minutes.

1. Briefly spin down the Barcode Attachment Plate to collect the liquid at the bottom of the wells prior to opening.
2. Pool the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.

   We expect to have about ~10 µl per sample.

   	X24 samples	X48 samples	X96 samples
   Total volume	~240 µl	~480 µl	~960 µl

3. Resuspend the AMPure XP Beads (AXP, or SPRI) by vortexing.
4. To the entire pooled barcoded sample, add an equal volume of resuspended AMPure XP Beads (AXP, or SPRI) and mix by flicking the tube.

   	x24 samples	x48 samples	x96 samples
   Volume of AXP to add	240 µl	480 µl	960 µl

5. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
6. Prepare at least 3 ml of fresh 80% ethanol in nuclease-free water.
7. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
8. Keep the tube on the magnet and wash the beads with 1.5 ml of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
9. Repeat the previous step.
10. Briefly spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.
11. Remove the tube from the magnetic rack and resuspend the pellet by pipetting in 30 µl Elution Buffer (EB). Incubate for 10 minutes at room temperature.
12. Pellet the beads on a magnet until the eluate is clear and colourless.
13. Remove and retain 30 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

    Dispose of the pelleted beads

14. Quantify DNA concentration by using the Qubit dsDNA HS Assay Kit.
15. Take forward 600–800 ng of library and make up the volume to 11 μl with EB.
16. Add 1 µl of Rapid Adapter F (RAP F) to 11 µl of barcoded DNA.
17. Incubate at room temperature for 5 minutes.
18. End of Step The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.

1. Tip Priming and loading a flow cell

   We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

2. Using the Loading Solution

   We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water.
   Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

3. Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down the SBII and FLT at room temperature.
4. Prepare the flow cell priming mix in a suitable vial for the number of flow cells to flush. Once combined, mix well by briefly vortexing.

   Reagent	Volume per flow cell
   Flush Tether (FLT)	30 µl
   Flush Buffer (FB)	1,170 µl

5. Open the MinION device lid and slide the flow cell under the clip.

   Press down firmly on the flow cell to ensure correct thermal and electrical contact.

   

   

6. Optional Action

   Complete a flow cell check to assess the number of pores available before loading the library.

   This step can be omitted if the flow cell has been checked previously.

   See the flow cell check instructions in the MinKNOW protocol for more information.

7. Slide the priming port cover clockwise to open the priming port.

   

8. Important Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
9. After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
   1. Set a P1000 pipette to 200 µl
   2. Insert the tip into the priming port
   3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
      

   Note: Visually check that there is continuous buffer from the priming port across the sensor array.

   

10. Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

    

11. Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.
12. Important The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.
13. In a new tube, prepare the library for loading as follows:

    Reagent	Volume per flow cell
    Sequencing Buffer II (SBII)	37.5 µl
    Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using	25.5 µl
    DNA library	12 µl
    Total	75 µl

    Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer II (SBII) and Loading Beads II (LBII) because the fuel in the buffer will start to be consumed by the adapter.

14. Complete the flow cell priming:
    1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
    2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

    

    

15. Mix the prepared library gently by pipetting up and down just prior to loading.
16. Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

    

17. Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

    

    

18. Important Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

    We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

19. Place the light shield onto the flow cell, as follows:

    1. Carefully place the leading edge of the light shield against the clip.
       Note: Do not force the light shield underneath the clip.

    2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

    

20. Caution The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
21. End of Step Close the device lid and set up a sequencing run on MinKNOW.

1. Overview of nanopore data analysis

   For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

2. Important Required settings in MinKNOW

   The correct barcoding parameters must be set up on MinKNOW prior to the sequencing run. During the run setup, in the Analysis tab:

   1. Enable Barcoding.
   2. Select Edit options.
   3. Enable Mid-read barcode filtering.
   4. Enable Override minimum barcoding score and set the value to 60.
   5. Enable Override minimum mid-read barcoding score and set the value to 50.

   

   

3. How to start sequencing

   The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:

   1. Data acquisition and basecalling in real-time using MinKNOW on a computer

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.

   2. Data acquisition and basecalling in real-time using the MinION Mk1B/Mk1D device

   Follow the instructions in the MinION Mk1B user manual or the MinION Mk1D user manual.

   3. Data acquisition and basecalling in real-time using the MinION Mk1C device

   Follow the instructions in the MinION Mk1C user manual.

   4. Data acquisition and basecalling in real-time using the GridION device

   Follow the instructions in the GridION user manual.

   5. Data acquisition and basecalling in real-time using the PromethION device

   Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.

   6. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.

1. Recommended analysis pipeline

   The recommended workflows for the bioinformatics analyses are provided by the ARTIC network and are documented on their web pages at https://artic.network/ncov-2019/ncov2019-bioinformatics-sop.html.

   The reference guided genome assembly and variant calling are also performed according to the bioinformatics protocol provided by the ARTIC network. Their best practices guide uses the software contained within the FieldBioinformatics project on GitHub.

   This workflow uses only the basecalled FASTQ files to perform a high-quality reference-guided assembly of the SARS-CoV-2 genome. Sequenced reads are re-demultiplexed with the requirement that reads must contain a barcode at both ends of the sequence (this only applies to the Classic and Eco PCR tiling of SARS-CoV-2 protocols but not the Rapid Barcoding PCR tiling of SARS-CoV-2), and must not contain internal barcodes. The reads are mapped to the reference genome, primer sequences are excluded and the consensus sequence is polished. The Medaka software is used to call single-nucleotide variants while the ARTIC software reports the high-quality consensus sequence from the workflow.

2. To further simplify the installation of the coronavirus bioinformatics protocols, the workflows have been packaged into two EPI2ME products

   The FieldBioinformatics workflow for SARS-CoV-2 sequence analysis is provided as a Jupyter notebook tutorial in the EPI2ME Labs software. The coronavirus workflow has been augmented to include additional steps that help with the quality control of individual libraries, and aid in the presentation of summary statistics and the final sets of called variants.

   The FieldBioinformatics workflow for SARS-CoV-2 sequence analysis is also provided as an EPI2ME workflow – this provides a more accessible interface to a bioinformatics workflow and the provided cloud-based analysis also performs some secondary interpretation by preparing an additional report using the Nextclade software.

3. Expected results - target coverage

   The graphs below show how many hours of sequencing was required to cover the SARS-CoV-2 genome to different depths of coverage using the PCR tiling of SARS-CoV-2 with SQK-RBK110.96 protocol. Higher depths of coverage and higher numbers of multiplexed samples require a longer sequencing time. However, in most cases, 8-12 hours are sufficient to achieve full coverage of the genome.

   
   Figure 1. Sequencing time required to cover the SARS-CoV-2 genome to different depths with increasing sample numbers per flow cell. This experiment used 1.2 kb amplicons barcoded using the Rapid Barcoding Kit 96 (SQK-RBK110.96) that were sequenced on the GridION.

   
   Figure 2. Sequencing time required to cover the SARS-CoV-2 genome to different depths with 96 samples. This experiment used 1.2 kb amplicons barcoded using the Rapid Barcoding Kit 96 (SQK-RBK110.96) that were sequenced on the PromethION.

   When assessing coverage of the genome with varying numbers of viral copies as input, 1000 copies of the Twist synthetic SARS-CoV-2 RNA control were sufficient for nearly full coverage.

   

   Figure 3. Coverage of the genome in a final consensus sequence prepared using the PCR tiling of SARS-CoV-2 using the Rapid Barcoding 96 protocol. 96 samples were sequenced on a single flow cell across an input titration gradient.

1. After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.

   The Flow Cell Wash Kit protocol is available on the Nanopore Community.

2. Tip We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
3. Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

   Instructions for returning flow cells can be found here.

4. Important If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation).	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

11. Guppy – no input .fast5 was found or basecalled

    Observation	Possible cause	Comments and actions
    No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
    No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

12. Guppy – no Pass or Fail folders were generated after basecalling

    Observation	Possible cause	Comments and actions
    No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

13. Guppy – unusually slow processing on a GPU computer

    Observation	Possible cause	Comments and actions
    Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.