Single-cell transcriptomics with cDNA prepared using 10X Genomics

Version for device: MinION

1. Important This is a Legacy product

   This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.

2. PCR-cDNA Sequencing Kit features

   This kit is highly recommended for users who:

   • would like to identify and quantify full-length transcripts
   • want to explore isoforms, splice variants and fusion transcripts using full-length cDNAs
   • would like to generate a large number of cDNA reads
3. Introduction to the single-cell transcriptomics protocol

   This protocol describes how to carry out sequencing of cDNA from single cells using the PCR-cDNA Sequencing Kit (SQK-PCS111). You will need to have reverse-transcribed single cell mRNA into cDNA using the 10X Genomics Next GEM Single Cell 3' Kit (V3.1).

   Steps in the sequencing workflow:

   Prepare for your experiment

   You will need to:
   - Have previously-prepared single-cell barcoded cDNA using the 10X Genomics Next GEM Single Cell 3' Kit (V3.1).
   The quality checks performed during the protocol are essential in ensuring experimental success.
   - Ensure you have your sequencing kit, the correct equipment and third-party reagents
   - Download the software for acquiring and analysing your data
   - Check your flow cell to ensure it has enough pores for a good sequencing run

   Library preparation

   You will need to:
   - Biotin tag your cDNAs and amplify by PCR
   - Pull down the amplicons on streptavidin beads, and amplify again by PCR
   - Attach sequencing adapters to the PCR products
   - Prime the flow cell, and load your cDNA library into the flow cell

   Sequencing and analysis

   You will need to:
   - Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
   - Analyse the data further using a pipeline of your choice

4. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • PCR-cDNA Sequencing Kit (SQK-PCS111)
   • R9.4.1 flow cells (FLO-MIN106)
   • Flow Cell Wash Kit (EXP-WSH004)

1. For this protocol, you will need 10 ng amplified cDNA amplicons prepared using 10X Genomics Next GEM Single Cell 3' Kits (V3.1).
2. Important 10X Genomics kits

   Note: This protocol is compatible and fully supported with 10X Genomics Next GEM Single Cell 3' Kit (V3.1) and the Visium Spatial Gene Expression Kit (V1). Other versions of the kits are not supported.

   The 10X Genomics Next GEM Single Cell 5' Kit (V2) is compatible with our Ligation sequencing V14 - Single-cell transcriptomics with 5' cDNA prepared using 10X Genomics on PromethION (SQK-LSK114) protocol.

3. Input DNA

   How to QC your input DNA

   It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

   For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

   Chemical contaminants

   Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

4. cDNA-PCR Sequencing Kit (SQK-PCS111) contents

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
   Strand Switching Primer II	SSPII	Violet	1	20 µl
   RT Primer	RTP	Yellow	1	10 µl
   cDNA RT Adapter	CRTA	Amber	1	10 µl
   Rapid Adapter T	RAP T	Green	1	10 µl
   Annealing Buffer	AB	Orange	1	10 µl
   cDNA Primer	cPRM	White cap, grey label	1	40 µl
   Elution Buffer	EB	Black	1	500 µl
   Short Fragment Buffer	SFB	Clear	1	1,800 µl
   Sequencing Buffer II	SBII	Red	1	500 µl
   Loading Beads II	LBII	Pink	1	360 µl
   Loading Solution	LS	White cap, pink label	1	400 µl
   Flush Buffer	FB	Blue	6	1,170 µl
   Flush Tether	FLT	White cap, purple label	1	200 µl

5. Custom-ordered oligo sequences

   Order the following HPLC-purified oligos at 100 μM, and dilute to 10 μM in TE buffer for use in the Pre-pull-down step of the library prep.

   Name	Sequence
   [Btn]Fwd_3580_partial_read1_defined	5'-/5Biosg/CAGCACTTGCCTGTCGCTCTATCTTC CTACACGACGCTCTTCCGATCT-3'
   Rev_PR2_partial_TSO_defined	5'-CAGCTTTCTGTTGGTGCTGATATTGCAAGCAGTGGTA TCAACGCAGAG-3'

1. MinION Mk1B IT requirements

   Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION Mk1B IT Requirements document.

2. Software for nanopore sequencing

   MinKNOW

   The MinKNOW software controls the nanopore sequencing device, collects sequencing data in real time and processes it into basecalls. You will be using MinKNOW for every sequencing experiment. MinKNOW can also demultiplex reads into folders for each barcode found in Oxford Nanopore library preparation kits, and basecall/demultiplex data after a sequencing run has completed.
   MinKNOW use
   For instructions on how to run the MinKNOW software, please refer to the relevant section in the MinKNOW protocol.

   EPI2ME (optional)

   The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You can the EPI2ME platform if you would like further analysis of your data post-basecalling. Please note that EPI2ME does not currently offer a workflow for single-cell transcriptomics analysis.
   EPI2ME installation and use
   For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

   Guppy (optional)

   The Guppy command-line software can be used instead of MinKNOW for basecalling and demultiplexing reads into folders for each barcode found in Oxford Nanopore library preparation kits. You can use it if you would like to re-analyse old data, or integrate basecalling into your analysis pipeline.
   Guppy installation and use
   If you would like to use the Guppy software, please refer to the Guppy protocol.

3. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

1. Set up the following biotin tagging reaction in a 0.2 ml thin-walled PCR tube:

   Reagent	Volume
   cDNA template	10 ng, x μl
   [Btn]Fwd_3580_partial_read1_defined, 10 μM	2 μl
   Rev_PR2_partial_TSO_defined, 10 μM	2 μl
   Nuclease-free water	21-x μl
   LongAmp Hot Start Taq 2X Master Mix	25 μl
   Total	50 μl

2. Amplify using the following cycling conditions:

   Cycle step	Temperature	Ramp rate	Time	No. of cycles
   Initial denaturation	94°C	max	3 min	1
   Denaturation Annealing ramp-down Annealing Extension	94°C 66°C down to 58°C 58°C 65°C	max 0.2°C/s max max	30 sec 40 sec 50 sec 6 mins	4
   Final extension	65°C	max	10 min	1
   Hold	4°C	-	∞	-

3. Resuspend the AMPure XP beads by vortexing.
4. Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
5. Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.
6. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
7. Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
8. Spin down the samples and pellet the beads on a magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off the supernatant.
9. Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
10. Repeat the previous step.
11. Briefly spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.
12. Remove the tube from the magnetic rack and resuspend the pellet in 10 µl nuclease-free water. Spin down and incubate for 2 minutes at room temperature.
13. Pellet the beads on a magnet until the eluate is clear and colourless.
14. Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

1. Prepare 4 ml of 2X wash/bind buffer (10 mM Tris-HCl pH 7.5, 2 M NaCl, 1 mM EDTA).

   Reagent	Stock concentration	Final concentration	Volume
   Tris-HCl pH 7.5	1 M	10 mM	40 μl
   NaCl	5 M	2 M	1600 μl
   EDTA	0.5 M	1 mM	8 μl
   Nuclease-free water	-	-	2352 μl
   Total	-	-	4000 μl

2. Transfer 3.5 ml of the 2X wash/bind buffer to a fresh 15 ml Falcon tube and add 3.5 ml of nuclease-free water to make 7 ml of 1X wash/bind buffer (5 mM Tris-HCl pH 7.5, 1 M NaCl, 0.5 mM EDTA).
3. Resuspend the M280 streptavidin beads (10 μg/μl) by vortexing.
4. Transfer 5 μl of the streptavidin beads to a clean 1.5 ml Eppendorf DNA LoBind tube.
5. Add 1 ml of 1X wash/bind buffer and vortex the beads with buffer for 5 seconds. Pellet the beads on a magnet for two minutes, then pipette off the supernatant.
6. Repeat the previous step two more times for a total of three washes.
7. Resuspend the beads in 10 μl of 2X wash/bind buffer to achieve a final bead concentration of 5 μg/μl.
8. Important It is critical that 2X buffer is used for this step. Using 1X buffer will result in inefficient binding.
9. Add 10 μl of 5 μg/μl prepared beads (50 μg beads total) to the tube with 10 μl of biotinylated cDNA.
10. Incubate on a Hula mixer (rotator mixer) for 20 minutes at room temperature.
11. Add 1 ml of 1X wash/bind buffer and vortex the DNA and beads with buffer for 5 seconds. Pellet the beads on a magnet for two minutes, then pipette off the supernatant. Take care to not aspirate any of the beads.
12. Repeat the previous step two more times for a total of three washes.
13. Add 200 μl of 10 mM Tris-HCl pH 7.5 and vortex the beads for 5 seconds.
14. Spin down and place the tube back on the magnet for three minutes. Pipette off the supernatant.
15. Remove the tube from the magnetic rack and resuspend the pellet in 20 μl of nuclease-free water. Vortex for 5 seconds and briefly spin down to collect the amplicon-bead conjugate.

1. In a 0.2 ml thin-walled PCR tube, prepare the following PCR reaction:

   Reagent	Volume
   cPRM	1 μl
   Nuclease-free water	4 μl
   LongAmp Hot Start Taq 2X Master Mix	25 μl
   Total	30 μl

2. Resuspend the amplicon-bead conjugate by pipetting and then transfer 20 μl of the conjugate into the 0.2 ml thin-walled PCR tube containing the PCR reaction. Mix by pipetting.
3. Do not spin down the tube; transfer immediately to the thermal cycler and amplify using the following cycling conditions:

   Cycle step	Temperature	Time	No. of cycles
   Initial denaturation	94°C	3 min	1
   Denaturation Annealing Extension	94°C 62°C 65°C	15 s 15 s 6 min	4
   Final extension	65°C	10 min	1
   Hold	4°C	∞	-

4. Resuspend the AMPure XP beads by vortexing.
5. Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
6. Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.
7. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
8. Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
9. Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.
10. Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
11. Repeat the previous step.
12. Briefly spin down and place the tubes back on the magnet for the beads to pellet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellets to the point of cracking.
13. Remove the tube from the magnetic rack and resuspend the pellet in 15 µl Elution Buffer (EB).
14. Pellet the beads on the magnet until the eluate is clear and colourless.
15. Remove and retain 15 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

    Dispose of the pelleted beads

16. Quantify 1 µl of eluted sample using a Qubit fluorometer - recovery aim >50 ng total.

1. Analyse 1 µl of sample using the Agilent Bioanalyzer. Determine the average amplicon size from this data, and use this to calculate the input sample volume for the next step.
2. Calculate the required sample volume for 35 fmol and dilute this into 12 μl of EB.
3. Add 0.5 μl of Rapid Adapter T (RAP T) to the amplified cDNA library.
4. Mix well by pipetting and spin down.
5. Incubate the reaction for 5 minutes at room temperature.
6. End of Step The prepared library is used for loading onto the flow cell. Store the library on ice until ready to load.

1. Tip Priming and loading a flow cell

   We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

2. Using the Loading Solution

   We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water.
   Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

3. Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down the SBII and FLT at room temperature.
4. Mix the Sequencing Buffer II (SBII), Flush Buffer (FB), Flush Tether (FLT) and Loading Solution (LS, if using) tubes by vortexing. Spin down the SBII and FLT at room temperature.
5. Prepare the flow cell priming mix: Add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing.
6. Open the MinION Mk1B lid and slide the flow cell under the clip.

   Press down firmly on the flow cell to ensure correct thermal and electrical contact.

   

   

7. Optional Action

   Complete a flow cell check to assess the number of pores available before loading the library.

   This step can be omitted if the flow cell has been checked previously.

   See the flow cell check instructions in the MinKNOW protocol for more information.

8. Slide the priming port cover clockwise to open the priming port.

   

9. Important Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
10. After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
    1. Set a P1000 pipette to 200 µl
    2. Insert the tip into the priming port
    3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
       

    Note: Visually check that there is continuous buffer from the priming port across the sensor array.

    

11. Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

    

12. Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.
13. Important The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.
14. In a new tube, prepare the library for loading as follows:

    Reagent	Volume per flow cell
    Sequencing Buffer II (SBII)	37.5 µl
    Loading Beads II (LBII), mixed immediately before use, or Loading Solution (LS), if using	25.5 µl
    DNA library	12 µl
    Total	75 µl

    Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer II (SBII) and Loading Beads II (LBII) because the fuel in the buffer will start to be consumed by the adapter.

15. Complete the flow cell priming:
    1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
    2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

    

    

16. Mix the prepared library gently by pipetting up and down just prior to loading.
17. Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

    

18. Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

    

    

19. Important Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

    We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

20. Place the light shield onto the flow cell, as follows:

    1. Carefully place the leading edge of the light shield against the clip.
       Note: Do not force the light shield underneath the clip.

    2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

    

21. Caution The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
22. End of Step Close the device lid and set up a sequencing run on MinKNOW.

1. Overview of nanopore data analysis

   For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

2. How to start sequencing

   The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:

   1. Data acquisition and basecalling in real-time using MinKNOW on a computer

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.

   2. Data acquisition and basecalling in real-time using the GridION device

   Follow the instructions in the GridION user manual.

   3. Data acquisition and basecalling in real-time using the MinION Mk1C device

   Follow the instructions in the MinION Mk1C user manual.

   4. Data acquisition and basecalling in real-time using the PromethION device

   Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.

   5. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.

1. EPI2ME provides a Nextflow-based workflow for the analysis of single-cell sequencing data.

   The workflow, wf-single-cell, processes the FASTQ format sequence data prepared by the MinKNOW software. The workflow screens each sequence read for 10X cell barcode information and assigns reads to a cell of origin. A subset of sequences from “true” cells are dynamically filtered on the basis of the number of assigned sequence reads. These sequences are mapped to the reference genome, and tables of both gene and transcript abundance are prepared for each cell. These "cell barcode x gene" or transcript abundance information are used to prepare the familiar UMAP plots that may show the stratification of the cell types present within the sample.

   For more information on this workflow, follow the link to the GitHub documentation.

1. After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at 2-8°C.

   The Flow Cell Wash Kit protocol is available on the Nanopore Community.

2. Tip We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
3. Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.

   Instructions for returning flow cells can be found here.

   Note: All flow cells must be flushed with deionised water before returning the product.

4. Important If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation).	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.

11. Guppy – no input .fast5 was found or basecalled

    Observation	Possible cause	Comments and actions
    No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
    No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

12. Guppy – no Pass or Fail folders were generated after basecalling

    Observation	Possible cause	Comments and actions
    No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

13. Guppy – unusually slow processing on a GPU computer

    Observation	Possible cause	Comments and actions
    Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.