Ligation sequencing gDNA - Native Barcoding Kit 96 V14 (SQK-NBD114.96)

Version for device: Flongle

Other available device versions: MinION

1. Introduction to the Native Barcoding Kit 96 V14 protocol

   This protocol describes how to carry out native barcoding of genomic DNA (gDNA) using the Native Barcoding Kit 96 V14 (SQK-NBD114.96). There are 96 unique barcodes available, allowing the user to pool up to 96 different samples in one sequencing experiment. It is highly recommended that a Lambda control experiment is completed first to become familiar with the technology.

   Steps in the sequencing workflow:

   Prepare for your experiment

   You will need to:

   • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
   • Ensure you have your sequencing kit, the correct equipment and third-party reagents
   • Download the software for acquiring and analysing your data
   • Check your flow cell to ensure it has enough pores for a good sequencing run

   Prepare your library

   You will need to:

   • Repair the gDNA, and prepare the DNA ends for adapter attachment
   • Ligate Native barcodes supplied in the kit to the DNA ends
   • Ligate sequencing adapters supplied in the kit to the DNA ends
   • Prime the flow cell, and load your DNA library into the flow cell

   

   Sequencing

   You will need to:

   • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
   • Demultiplex barcoded reads in MinKNOW or the Guppy basecalling, choosing the SQK-NBD114.96 kit option
   • Start the EPI2ME software and select a workflow for further analysis (this step is optional)
2. Important We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.
3. Important Optional fragmentation and size selection

   By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

   Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

4. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • Native Barcoding Kit 96 V14 (SQK-NBD114.96)
   • Flongle Sequencing Expansion (EXP-FSE002)
   • R10.4.1 Flongle flow cells (FLO-FLG114)
   • Native Barcoding Expansion V14 (EXP-NBA114)

1. Important Flow cell deterioration/saturation

   At Oxford Nanopore we look to continuously improve our production processes to deliver a more robust product. In the case of Flongle, we are seeing the stability of the flow cells we ship improve. However for a small number of flow cells, upon loading, the flow cell rapidly deteriorates. This can be seen as saturation in the MinKNOW GUI. We are working hard to resolve this, however in the meantime we suggest the following loading recommendations and to use the buffers from the Flongle Sequencing Expansion (EXP-FSE002) shipped with your Flongle flow cells. If you do see rapid deteriorate/saturation on your flow cell, please contact support@nanoporetech.com for assistance.

   Loading recommendations
   Following standard input recommendations, the protocol should produce enough final library (adapted DNA in EB) to load at least two Flongle flow cells. We recommend reserving enough library to load a second Flongle flow cell should you need to generate more data from a second flongle flow cell.

2. Important Flongle Sequencing Expansion (EXP-FSE002)

   There are three buffers that come into direct contact with a flow cell at point of loading (SB: Sequencing Buffer, FCF: Flow Cell Flush and LIB: Library Beads or LIS: Library Solution). When looking at these buffers, we found that there are a very low level of contaminants seeping out of the plastic vials that impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   We have found that when storing these buffers in glass vials instead of plastic, incidence of deterioration is reduced.

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE002) with these three components in glass vials, which can perform 12 Flongle flow cell loads in total.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE002) components
   - Sequencing Buffer (SB)
   - Flow Cell Flush (FCF)
   - Library Beads (LIB) or Library Solution (LIS)

   Sequencing Kit components
   - Flow Cell Tether (FCT)

   Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.

3. For this protocol, you will need 400 ng DNA per barcode.
4. Input DNA

   How to QC your input DNA

   It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

   For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

   Chemical contaminants

   Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

5. Third-party reagents

   We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

   For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

6. Important The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.
7. Native Barcoding Kit 96 V14 (SQK-NBD114.96) contents

   Note: We are in the process of updating our kits with reduced EDTA concentration.

   Higher EDTA concentration format:

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
   Native Barcode plate	NB01-96	-	3 plates	8 µl per well
   DNA Control Sample	DCS	Yellow	3	35
   Native Adapter	NA	Green	2	40
   Sequencing Buffer	SB	Red	2	700
   Library Beads	LIB	Pink	2	600
   Library Solution	LIS	White cap, pink label	2	600
   Elution Buffer	EB	Black	1	1,500
   AMPure XP Beads	AXP	Amber	1	6,000
   Long Fragment Buffer	LFB	Orange	1	7,500
   Short Fragment Buffer	SFB	Clear	1	7,500
   EDTA†	EDTA	Clear	1	700
   Flow Cell Flush	FCF	Blue	1	15,500
   Flow Cell Tether	FCT	Purple	2	200

   † Higher concentration of EDTA with a clear cap.

   
   

   Reduced EDTA concentration format:

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
   Native Barcode plate	NB01-96	-	3 plates	8 µl per well
   DNA Control Sample	DCS	Yellow	3	35
   Native Adapter	NA	Green	2	40
   Sequencing Buffer	SB	Red	2	700
   Library Beads	LIB	Pink	2	600
   Library Solution	LIS	White cap, pink label	2	600
   Elution Buffer	EB	Black	1	1,500
   AMPure XP Beads	AXP	Clear cap, light teal	1	6,000
   Long Fragment Buffer	LFB	Clear cap, orange label	1	7,500
   Short Fragment Buffer	SFB	Clear cap, dark blue label	1	7,500
   EDTA‡	EDTA	Blue	1	700
   Flow Cell Flush	FCF	Clear cap, light blue label	1	15,500
   Flow Cell Tether	FCT	Purple	2	200

   ‡ Reduced concentration of EDTA with a blue cap.

   Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

   The barcodes are orientated in columns in the barcode plate.

   

   Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.

8. Flongle Sequencing Expansion (EXP-FSE002) contents

   

   Name	Acronym	Cap colour	Number of vials	Fill volume per vial (µl)
   Sequencing Buffer	SB	Blue	1	250
   Library Beads	LIB	Blue	1	200
   Library Solution	LIS	Blue	1	200
   Flow Cell Flush	FCF	Blue	1	1,600

   Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.

9. Important Please note that Oxford Nanopore Technologies deem the useful life of the Flongle Sequencing Expansion (EXP-FSE002) to be 6 months from receipt by the customer.
10. To maximise the use of the Native Barcoding Kits, the Native Barcode Auxiliary V14 (EXP-NBA114) expansion pack is available.

    This expansion provides extra library preparation reagents to allow users to utilise any unused barcodes for those running in smaller subsets.

    This expansion pack will provide enough reagents for 12 reactions.

    Native Barcode Auxiliary V14 (EXP-NBA114) contents:

    

    Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
    Native Adapter	NA	Green	2	40
    AMPure XP Beads	AXP	Amber	1	400
    Long Fragment Buffer	LFB	Orange	2	1,800
    Short Fragment Buffer	SFB	Clear	2	1,800

    Note: This Product contains AMPure XP Reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

11. Native barcode sequences

    Component	Forward sequence	Reverse sequence
    NB01	CACAAAGACACCGACAACTTTCTT	AAGAAAGTTGTCGGTGTCTTTGTG
    NB02	ACAGACGACTACAAACGGAATCGA	TCGATTCCGTTTGTAGTCGTCTGT
    NB03	CCTGGTAACTGGGACACAAGACTC	GAGTCTTGTGTCCCAGTTACCAGG
    NB04	TAGGGAAACACGATAGAATCCGAA	TTCGGATTCTATCGTGTTTCCCTA
    NB05	AAGGTTACACAAACCCTGGACAAG	CTTGTCCAGGGTTTGTGTAACCTT
    NB06	GACTACTTTCTGCCTTTGCGAGAA	TTCTCGCAAAGGCAGAAAGTAGTC
    NB07	AAGGATTCATTCCCACGGTAACAC	GTGTTACCGTGGGAATGAATCCTT
    NB08	ACGTAACTTGGTTTGTTCCCTGAA	TTCAGGGAACAAACCAAGTTACGT
    NB09	AACCAAGACTCGCTGTGCCTAGTT	AACTAGGCACAGCGAGTCTTGGTT
    NB10	GAGAGGACAAAGGTTTCAACGCTT	AAGCGTTGAAACCTTTGTCCTCTC
    NB11	TCCATTCCCTCCGATAGATGAAAC	GTTTCATCTATCGGAGGGAATGGA
    NB12	TCCGATTCTGCTTCTTTCTACCTG	CAGGTAGAAAGAAGCAGAATCGGA
    NB13	AGAACGACTTCCATACTCGTGTGA	TCACACGAGTATGGAAGTCGTTCT
    NB14	AACGAGTCTCTTGGGACCCATAGA	TCTATGGGTCCCAAGAGACTCGTT
    NB15	AGGTCTACCTCGCTAACACCACTG	CAGTGGTGTTAGCGAGGTAGACCT
    NB16	CGTCAACTGACAGTGGTTCGTACT	AGTACGAACCACTGTCAGTTGACG
    NB17	ACCCTCCAGGAAAGTACCTCTGAT	ATCAGAGGTACTTTCCTGGAGGGT
    NB18	CCAAACCCAACAACCTAGATAGGC	GCCTATCTAGGTTGTTGGGTTTGG
    NB19	GTTCCTCGTGCAGTGTCAAGAGAT	ATCTCTTGACACTGCACGAGGAAC
    NB20	TTGCGTCCTGTTACGAGAACTCAT	ATGAGTTCTCGTAACAGGACGCAA
    NB21	GAGCCTCTCATTGTCCGTTCTCTA	TAGAGAACGGACAATGAGAGGCTC
    NB22	ACCACTGCCATGTATCAAAGTACG	CGTACTTTGATACATGGCAGTGGT
    NB23	CTTACTACCCAGTGAACCTCCTCG	CGAGGAGGTTCACTGGGTAGTAAG
    NB24	GCATAGTTCTGCATGATGGGTTAG	CTAACCCATCATGCAGAACTATGC
    NB25	GTAAGTTGGGTATGCAACGCAATG	CATTGCGTTGCATACCCAACTTAC
    NB26	CATACAGCGACTACGCATTCTCAT	ATGAGAATGCGTAGTCGCTGTATG
    NB27	CGACGGTTAGATTCACCTCTTACA	TGTAAGAGGTGAATCTAACCGTCG
    NB28	TGAAACCTAAGAAGGCACCGTATC	GATACGGTGCCTTCTTAGGTTTCA
    NB29	CTAGACACCTTGGGTTGACAGACC	GGTCTGTCAACCCAAGGTGTCTAG
    NB30	TCAGTGAGGATCTACTTCGACCCA	TGGGTCGAAGTAGATCCTCACTGA
    NB31	TGCGTACAGCAATCAGTTACATTG	CAATGTAACTGATTGCTGTACGCA
    NB32	CCAGTAGAAGTCCGACAACGTCAT	ATGACGTTGTCGGACTTCTACTGG
    NB33	CAGACTTGGTACGGTTGGGTAACT	AGTTACCCAACCGTACCAAGTCTG
    NB34	GGACGAAGAACTCAAGTCAAAGGC	GCCTTTGACTTGAGTTCTTCGTCC
    NB35	CTACTTACGAAGCTGAGGGACTGC	GCAGTCCCTCAGCTTCGTAAGTAG
    NB36	ATGTCCCAGTTAGAGGAGGAAACA	TGTTTCCTCCTCTAACTGGGACAT
    NB37	GCTTGCGATTGATGCTTAGTATCA	TGATACTAAGCATCAATCGCAAGC
    NB38	ACCACAGGAGGACGATACAGAGAA	TTCTCTGTATCGTCCTCCTGTGGT
    NB39	CCACAGTGTCAACTAGAGCCTCTC	GAGAGGCTCTAGTTGACACTGTGG
    NB40	TAGTTTGGATGACCAAGGATAGCC	GGCTATCCTTGGTCATCCAAACTA
    NB41	GGAGTTCGTCCAGAGAAGTACACG	CGTGTACTTCTCTGGACGAACTCC
    NB42	CTACGTGTAAGGCATACCTGCCAG	CTGGCAGGTATGCCTTACACGTAG
    NB43	CTTTCGTTGTTGACTCGACGGTAG	CTACCGTCGAGTCAACAACGAAAG
    NB44	AGTAGAAAGGGTTCCTTCCCACTC	GAGTGGGAAGGAACCCTTTCTACT
    NB45	GATCCAACAGAGATGCCTTCAGTG	CACTGAAGGCATCTCTGTTGGATC
    NB46	GCTGTGTTCCACTTCATTCTCCTG	CAGGAGAATGAAGTGGAACACAGC
    NB47	GTGCAACTTTCCCACAGGTAGTTC	GAACTACCTGTGGGAAAGTTGCAC
    NB48	CATCTGGAACGTGGTACACCTGTA	TACAGGTGTACCACGTTCCAGATG
    NB49	ACTGGTGCAGCTTTGAACATCTAG	CTAGATGTTCAAAGCTGCACCAGT
    NB50	ATGGACTTTGGTAACTTCCTGCGT	ACGCAGGAAGTTACCAAAGTCCAT
    NB51	GTTGAATGAGCCTACTGGGTCCTC	GAGGACCCAGTAGGCTCATTCAAC
    NB52	TGAGAGACAAGATTGTTCGTGGAC	GTCCACGAACAATCTTGTCTCTCA
    NB53	AGATTCAGACCGTCTCATGCAAAG	CTTTGCATGAGACGGTCTGAATCT
    NB54	CAAGAGCTTTGACTAAGGAGCATG	CATGCTCCTTAGTCAAAGCTCTTG
    NB55	TGGAAGATGAGACCCTGATCTACG	CGTAGATCAGGGTCTCATCTTCCA
    NB56	TCACTACTCAACAGGTGGCATGAA	TTCATGCCACCTGTTGAGTAGTGA
    NB57	GCTAGGTCAATCTCCTTCGGAAGT	ACTTCCGAAGGAGATTGACCTAGC
    NB58	CAGGTTACTCCTCCGTGAGTCTGA	TCAGACTCACGGAGGAGTAACCTG
    NB59	TCAATCAAGAAGGGAAAGCAAGGT	ACCTTGCTTTCCCTTCTTGATTGA
    NB60	CATGTTCAACCAAGGCTTCTATGG	CCATAGAAGCCTTGGTTGAACATG
    NB61	AGAGGGTACTATGTGCCTCAGCAC	GTGCTGAGGCACATAGTACCCTCT
    NB62	CACCCACACTTACTTCAGGACGTA	TACGTCCTGAAGTAAGTGTGGGTG
    NB63	TTCTGAAGTTCCTGGGTCTTGAAC	GTTCAAGACCCAGGAACTTCAGAA
    NB64	GACAGACACCGTTCATCGACTTTC	GAAAGTCGATGAACGGTGTCTGTC
    NB65	TTCTCAGTCTTCCTCCAGACAAGG	CCTTGTCTGGAGGAAGACTGAGAA
    NB66	CCGATCCTTGTGGCTTCTAACTTC	GAAGTTAGAAGCCACAAGGATCGG
    NB67	GTTTGTCATACTCGTGTGCTCACC	GGTGAGCACACGAGTATGACAAAC
    NB68	GAATCTAAGCAAACACGAAGGTGG	CCACCTTCGTGTTTGCTTAGATTC
    NB69	TACAGTCCGAGCCTCATGTGATCT	AGATCACATGAGGCTCGGACTGTA
    NB70	ACCGAGATCCTACGAATGGAGTGT	ACACTCCATTCGTAGGATCTCGGT
    NB71	CCTGGGAGCATCAGGTAGTAACAG	CTGTTACTACCTGATGCTCCCAGG
    NB72	TAGCTGACTGTCTTCCATACCGAC	GTCGGTATGGAAGACAGTCAGCTA
    NB73	AAGAAACAGGATGACAGAACCCTC	GAGGGTTCTGTCATCCTGTTTCTT
    NB74	TACAAGCATCCCAACACTTCCACT	AGTGGAAGTGTTGGGATGCTTGTA
    NB75	GACCATTGTGATGAACCCTGTTGT	ACAACAGGGTTCATCACAATGGTC
    NB76	ATGCTTGTTACATCAACCCTGGAC	GTCCAGGGTTGATGTAACAAGCAT
    NB77	CGACCTGTTTCTCAGGGATACAAC	GTTGTATCCCTGAGAAACAGGTCG
    NB78	AACAACCGAACCTTTGAATCAGAA	TTCTGATTCAAAGGTTCGGTTGTT
    NB79	TCTCGGAGATAGTTCTCACTGCTG	CAGCAGTGAGAACTATCTCCGAGA
    NB80	CGGATGAACATAGGATAGCGATTC	GAATCGCTATCCTATGTTCATCCG
    NB81	CCTCATCTTGTGAAGTTGTTTCGG	CCGAAACAACTTCACAAGATGAGG
    NB82	ACGGTATGTCGAGTTCCAGGACTA	TAGTCCTGGAACTCGACATACCGT
    NB83	TGGCTTGATCTAGGTAAGGTCGAA	TTCGACCTTACCTAGATCAAGCCA
    NB84	GTAGTGGACCTAGAACCTGTGCCA	TGGCACAGGTTCTAGGTCCACTAC
    NB85	AACGGAGGAGTTAGTTGGATGATC	GATCATCCAACTAACTCCTCCGTT
    NB86	AGGTGATCCCAACAAGCGTAAGTA	TACTTACGCTTGTTGGGATCACCT
    NB87	TACATGCTCCTGTTGTTAGGGAGG	CCTCCCTAACAACAGGAGCATGTA
    NB88	TCTTCTACTACCGATCCGAAGCAG	CTGCTTCGGATCGGTAGTAGAAGA
    NB89	ACAGCATCAATGTTTGGCTAGTTG	CAACTAGCCAAACATTGATGCTGT
    NB90	GATGTAGAGGGTACGGTTTGAGGC	GCCTCAAACCGTACCCTCTACATC
    NB91	GGCTCCATAGGAACTCACGCTACT	AGTAGCGTGAGTTCCTATGGAGCC
    NB92	TTGTGAGTGGAAAGATACAGGACC	GGTCCTGTATCTTTCCACTCACAA
    NB93	AGTTTCCATCACTTCAGACTTGGG	CCCAAGTCTGAAGTGATGGAAACT
    NB94	GATTGTCCTCAAACTGCCACCTAC	GTAGGTGGCAGTTTGAGGACAATC
    NB95	CCTGTCTGGAAGAAGAATGGACTT	AAGTCCATTCTTCTTCCAGACAGG
    NB96	CTGAACGGTCATAGAGTCCACCAT	ATGGTGGACTCTATGACCGTTCAG

1. MinION Mk1C IT requirements

   The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. Read more in the MinION Mk1C IT requirements document.

2. MinION Mk1B IT requirements

   Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION Mk1B IT Requirements document.

3. Software for nanopore sequencing

   MinKNOW

   The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

   For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

   EPI2ME (optional)

   The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

   For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

4. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

1. Important Flow cell deterioration/saturation

   At Oxford Nanopore we look to continuously improve our production processes to deliver a more robust product. In the case of Flongle, we are seeing the stability of the flow cells we ship improve. However for a small number of flow cells, upon loading, the flow cell rapidly deteriorates. This can be seen as saturation in the MinKNOW GUI. We are working hard to resolve this, however in the meantime we suggest the following loading recommendations and to use the buffers from the Flongle Sequencing Expansion (EXP-FSE002) shipped with your Flongle flow cells. If you do see rapid deteriorate/saturation on your flow cell, please contact support@nanoporetech.com for assistance.

   Loading recommendations
   Following standard input recommendations, the protocol should produce enough final library (adapted DNA in EB) to load at least two Flongle flow cells. We recommend reserving enough library to load a second Flongle flow cell should you need to generate more data from a second flongle flow cell.

2. Important Flongle Sequencing Expansion (EXP-FSE002)

   There are three buffers that come into direct contact with a flow cell at point of loading (SB: Sequencing Buffer, FCF: Flow Cell Flush and LIB: Library Beads or LIS: Library Solution). When looking at these buffers, we found that there are a very low level of contaminants seeping out of the plastic vials that impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   We have found that when storing these buffers in glass vials instead of plastic, incidence of deterioration is reduced.

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE002) with these three components in glass vials, which can perform 12 Flongle flow cell loads in total.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE002) components
   - Sequencing Buffer (SB)
   - Flow Cell Flush (FCF)
   - Library Beads (LIB) or Library Solution (LIS)

   Sequencing Kit components
   - Flow Cell Tether (FCT)

   Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.

3. Tip For samples containing long gDNA fragments, we recommend using wide-bore pipette tips for the mixing steps to preserve the DNA length.
4. Thaw the DNA Control Sample (DCS) at room temperature, mix by vortexing, and place on ice.
5. Prepare the NEBNext FFPE DNA Repair Mix and NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer’s instructions, and place on ice.

   For optimal performance, NEB recommend the following:

   1. Thaw all reagents on ice.

   2. Flick and/or invert the reagent tubes to ensure they are well mixed.
      
      Note: Do not vortex the FFPE DNA Repair Mix or Ultra II End Prep Enzyme Mix.

   3. Always spin down tubes before opening for the first time each day.

   4. The Ultra II End Prep Buffer and FFPE DNA Repair Buffer may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for 30 seconds to solubilise any precipitate.
      
      Note: It is important the buffers are mixed well by vortexing.

   5. The FFPE DNA Repair Buffer may have a yellow tinge and is fine to use if yellow.

6. Important Do not vortex the NEBNext FFPE DNA Repair Mix or NEBNext Ultra II End Prep Enzyme Mix.
7. Important It is important that the NEBNext FFPE DNA Repair Buffer and NEBNext Ultra II End Prep Reaction Buffer are mixed well by vortexing.

   Check for any visible precipitate; vortexing for at least 30 seconds may be required to solubilise any precipitate.

8. Dilute your DNA Control Sample (DCS) by adding 105 µl Elution Buffer (EB) directly to one DCS tube. Mix gently by pipetting and spin down.

   One tube of diluted DNA Control Sample (DCS) is enough for 140 samples. Excess can be stored at -20°C in the freezer.

9. Tip We recommend using the DNA Control Sample (DCS) in your library prep for troubleshooting purposes. However, you can omit this step and make up the extra 1 µl with your sample DNA.
10. In a clean 96-well plate, aliquot 400 ng DNA per sample.
11. Make up each sample to 11 µl using nuclease-free water. Mix gently by pipetting and spin down.
12. Combine the following components per well:

    Between each addition, pipette mix 10-20 times.

    Reagent	Volume
    DNA sample	11 µl
    Diluted DNA Control Sample (DCS)	1 µl
    NEBNext FFPE DNA Repair Buffer	0.875 µl
    Ultra II End-prep Reaction Buffer	0.875 µl
    Ultra II End-prep Enzyme Mix	0.75 µl
    NEBNext FFPE DNA Repair Mix	0.5 µl
    Total	15 µl

13. Tip We recommend making up a mastermix of the end-prep and DNA repair reagents for the total number of samples and adding 3 µl to each well.
14. Ensure the components are thoroughly mixed by pipetting and spin down briefly.
15. Using a thermal cycler, incubate at 20°C for 5 minutes and 65°C for 5 minutes.
16. End of Step Take forward the end-prepped DNA into the native barcode ligation step.

    If users want to pause the library preparation here, we recommend cleaning up your sample with 1X AMPure XP Beads (AXP) and eluting in nuclease-free water before storing at 4°C.

    Please note, extra AMPure XP Beads (AXP) will be required for this optional step.

1. Prepare the NEB Blunt/TA Ligase Master Mix and NEBNext Quick Ligation Module according to the manufacturers instructions, and place on ice.
   • Thaw the reagents at room temperature.
   • Spin down the reagent tubes for 5 seconds.
   • Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.

2. Thaw the AMPure XP Beads (AXP) at room temperature and mix by vortexing. Keep the beads at room temperature.
3. Thaw the EDTA at room temperature and mix by vortexing. Then spin down and place on ice.
4. Thaw the Native Barcodes (NB01-96) required for your number of samples at room temperature. Individually mix the barcodes by pipetting, spin down, and place them on ice.
5. Select a unique barcode for every sample to be run together on the same flow cell. Up to 96 samples can be barcoded and combined in one experiment.

   Please note: Only use one barcode per sample.

6. In a new 96-well plate, add the reagents in the following order per well mixing well by pipetting between each addition:

   Reagent	Volume
   Nuclease-free water	3 µl
   End-prepped DNA	0.75 µl
   Native Barcode (NB01-96)	1.25 µl
   Blunt/TA Ligase Master Mix	5 µl
   Total	10 µl

7. Thoroughly mix the reaction by gently pipetting and briefly spinning down.
8. Incubate for 20 minutes at room temperature.
9. Add the following volume of EDTA to each well and mix thoroughly by pipetting and spin down briefly.

   Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

   EDTA cap colour	Volume per well
   For clear cap EDTA	1 µl
   For blue cap EDTA	2 µl

10. Tip EDTA is added at this step to stop the reaction.
11. Pool the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.

    Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

    	Volume per sample	For 24 samples	For 48 samples	For 96 samples
    Total volume for preps using clear cap EDTA	11 µl	264 µl	528 µl	1,056 µl
    Total volume for preps using blue cap EDTA	12 µl	288 µl	576 µl	1,152 µl

12. Tip We recommend checking the base of your tubes/plate are all the same volume before pooling and after to ensure all the liquid has been taken forward.
13. Resuspend the AMPure XP Beads (AXP) by vortexing.
14. Add 0.4X AMPure XP Beads (AXP) to the pooled reaction, and mix by pipetting.

    Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

    	Volume per sample	For 24 samples	For 48 samples	For 96 samples
    Volume of AXP for preps using clear cap EDTA	4 µl	106 µl	211 µl	422 µl
    Volume of AXP for preps using blue cap EDTA	5 µl	115 µl	230 µl	461 µl

15. Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.
16. Prepare 2 ml of fresh 80% ethanol in nuclease-free water.
17. Spin down the sample and pellet on a magnet for 5 minutes. Keep the plate on the magnetic rack until the eluate is clear and colourless, and pipette off the supernatant.
18. Keep the tube on the magnetic rack and wash the beads with 700 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

    If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.

19. Repeat the previous step.
20. Spin down and place the tube back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
21. Remove the tube from the magnetic rack and resuspend the pellet in 35 µl nuclease-free water by gently flicking.
22. Incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.
23. Pellet the beads on a magnetic rack until the eluate is clear and colourless.
24. Remove and retain 35 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
25. Quantify 1 µl of eluted sample using a Qubit fluorometer.
26. End of Step Take forward the barcoded DNA library to the adapter ligation and clean-up step. However, you may store the sample at 4°C overnight.

1. Important The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.
2. Prepare the NEBNext Quick Ligation Reaction Module according to the manufacturer's instructions, and place on ice:

   1. Thaw the reagents at room temperature.

   2. Spin down the reagent tubes for 5 seconds.

   3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.
      Note: Do NOT vortex the Quick T4 DNA Ligase.

   The NEBNext Quick Ligation Reaction Buffer (5x) may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.

3. Important Do not vortex the Quick T4 DNA Ligase.
4. Spin down the Native Adapter (NA) and Quick T4 DNA Ligase, pipette mix and place on ice.
5. Thaw the Elution Buffer (EB) at room temperature and mix by vortexing. Then spin down and place on ice.
6. Important Depending on the wash buffer (LFB or SFB) used, the clean-up step after adapter ligation is designed to either enrich for DNA fragments of >3 kb, or purify all fragments equally.
   • To enrich for DNA fragments of 3 kb or longer, use Long Fragment Buffer (LFB)
   • To retain DNA fragments of all sizes, use Short Fragment Buffer (SFB)
7. Thaw either Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB) at room temperature and mix by vortexing. Then spin down and place on ice.
8. In a 1.5 ml Eppendorf LoBind tube, mix in the following order:

   Between each addition, pipette mix 10 - 20 times.

   Reagent	Volume
   Pooled barcoded sample	30 µl
   Native Adapter (NA)	5 µl
   NEBNext Quick Ligation Reaction Buffer (5X)	10 µl
   Quick T4 DNA Ligase	5 µl
   Total	50 µl

9. Thoroughly mix the reaction by gently pipetting and briefly spinning down.
10. Incubate the reaction for 20 minutes at room temperature.
11. Important The next clean-up step uses Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB) rather than 80% ethanol to wash the beads. The use of ethanol will be detrimental to the sequencing reaction.
12. Resuspend the AMPure XP Beads (AXP) by vortexing.
13. Add 20 µl of resuspended AMPure XP Beads (AXP) to the reaction and mix by pipetting.
14. Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.
15. Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnet and pipette off the supernatant.
16. Wash the beads by adding either 125 μl Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.
17. Repeat the previous step.
18. Spin down and place the tube back on the magnet. Pipette off any residual supernatant.
19. Remove the tube from the magnetic rack and resuspend pellet in 7 µl Elution Buffer (EB).
20. Spin down and incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.
21. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
22. Remove and retain 7 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

    Dispose of the pelleted beads

23. Quantify 1 µl of eluted sample using a Qubit fluorometer.
24. Prepare your final library to 5-10 fmol in 5 µl of Elution Buffer (EB).

    If required, we recommend using a mass to mol calculator such as the NEB calculator.

25. Important We recommend loading 5-10 fmol of this final prepared library onto the R10.4.1 flow cell.

    Following standard input recommendations, the protocol should produce enough final library (adapter DNA in EB) to load at least two Flongle flow cells. We recommend reserving enough library to load onto a second flow cell. Loading more than 10 fmol can have a detrimental effect on output. Dilute the library in EB or nuclease-free water to a final volume of 5 μl.

26. End of Step The prepared library is used for loading onto the flow cell. Store the library on ice or at 4°C until ready to load.
27. Tip Library storage recommendations

    We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short-term storage or repeated use, for example, re-loading flow cells between washes.
    For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

28. Optional Action

    If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

    Depending on how many flow cells the library will be split across, more Elution Buffer (EB) than what is supplied in the kit will be required.

1. Important Please note, this kit is only compatible with R10.4.1 flow cells (FLO-FLG114).
2. Important Flongle Sequencing Expansion (EXP-FSE002)

   There are three buffers that come into direct contact with a flow cell at point of loading (SB: Sequencing Buffer, FCF: Flow Cell Flush and LIB: Library Beads or LIS: Library Solution). When looking at these buffers, we found that there are a very low level of contaminants seeping out of the plastic vials that impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   We have found that when storing these buffers in glass vials instead of plastic, incidence of deterioration is reduced.

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE002) with these three components in glass vials, which can perform 12 Flongle flow cell loads in total.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE002) components
   - Sequencing Buffer (SB)
   - Flow Cell Flush (FCF)
   - Library Beads (LIB) or Library Solution (LIS)

   Sequencing Kit components
   - Flow Cell Tether (FCT)

   Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.

3. Important Do NOT touch the reverse side of the Flongle flow cell array or the contact pads on the Flongle adapter. ALWAYS wear gloves when handling Flongle flow cells and adapters to avoid damage to the flow cell or adapter.

   

4. The diagram below shows the components of the Flongle flow cell:

   

   The seal tab, air vent, waste channel, drain port and sample port are visible here. The sample port, drain port and air vent only become accessible once the seal tab is peeled back.

5. Thaw the Sequencing Buffer (SB), Library Beads (LIB) or Library Solution (LIS, if using), Flow Cell Tether (FCT) and Flow Cell Flush (FCF) at room temperature before mixing by vortexing. Then spin down and store on ice.
6. In a fresh 1.5 ml Eppendorf DNA LoBind tube, mix 117 µl of Flow Cell Flush (FCF) with 3 µl of Flow Cell Tether (FCT) and mix by pipetting.
7. Place the Flongle adapter into the MinION or one of the five GridION positions.

   The adapter should sit evenly and flat on the MinION Mk1B or GridION platform. This ensures the flow cell assembly is flat during the next stage.

8. Important The adapter needs to be plugged into your device, and the device should be plugged in and powered on before inserting the Flongle flow cell.

   

9. Place the flow cell into the Flongle adapter, and press the flow cell down until you hear a click.

   The flow cell should sit evenly and flat inside the adapter, to avoid any bubbles forming inside the fluidic compartments.

   

10. Important How to prime and load a Flongle flow cell

11. Peel back the seal tab from the Flongle flow cell, up to a point where the sample port is exposed, as follows:

    1. Lift up the seal tab:
       
       
       

    2. Pull the seal tab to open access to the sample port:
       
       
       

    3. Hold the seal tab open by using adhesive on the tab to stick to the MinION Mk 1B lid:
       

12. To prime your flow cell with the mix of Flow Cell Flush (FCF) and Flow Cell Tether (FCT) that was prepared earlier, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 pipette tip inside the sample port and slowly dispense the 120 µl of priming fluid into the Flongle flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

    

13. Important The Library Beads (LIB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

    We recommend using the Library Beads (LIB) for most sequencing experiments. However, the Library Solution (LIS) is available for more viscous libraries.

14. Vortex the vial of Library Beads (LIB). Note that the beads settle quickly, so immediately prepare the Sequencing Mix in a fresh 1.5 ml Eppendorf DNA LoBind tube for loading the Flongle, as follows:

    Reagents	Volume
    Sequencing Buffer (SB)	15 µl
    Library Beads (LIB) mixed immediately before use, or Library Solution (LIS), if using.	10 µl
    DNA library	5 µl
    Total	30 µl

15. To add the Sequencing Mix to the flow cell, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 tip inside the sample port and slowly dispense the Sequencing Mix into the flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

    

16. Seal the Flongle flow cell using the adhesive on the seal tab, as follows:

    1. Stick the transparent adhesive tape to the sample port.
       
       
       

    2. Replace the top (Wheel icon section) of the seal tab to its original position.
       

17. End of Step Close the device lid and set up a sequencing run on MinKNOW.

1. How to start sequencing

   Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

   MinKNOW can be used and set up to sequence in multiple ways:

   • On a computer either direcly or remotely connected to a sequencing device.
   • Directly on a GridION, MinION Mk1C or PromethION 24/48 sequencing device.

   For more information on using MinKNOW on a sequencing device, please see the device user manuals:

   • MinION Mk1C user manual
   • MinION Mk1B user manual
   • GridION user manual

   ---

   To start a sequencing run on MinKNOW:

   1. Navigate to the start page and click Start sequencing.
   

   2. Fill in your experiment details, such as name and flow cell position and sample ID.
   

   3. Select the sequencing kit used in the library preparation on the Kit page.
   

   4. Configure the sequencing parameters for your sequencing run or keep to the default settings on the Run options and Analysis tabs.

   Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

   5. On the Output page, set up the output parameters or keep to the default settings.
   

   6. Click Start on the Review page to start the sequencing run.
   

2. Duplex basecalling

   Kit 14 chemistry has improved duplex basecalling which requires rebasecalling on Dorado after simplex basecalling has been performed on MinKNOW.

   For detailed information on setting up your sequencing run, for both simplex and duplex basecalling, please see the Kit 14 sequencing and duplex basecalling info sheet.

   Note: When running Dorado, we recommend stopping other basecalling for the best performance by maximising memory available to Dorado. This can be stopped and restarted when Dorado has finished via the GUI on MinKNOW.

3. Data analysis after sequencing

   After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

   In the Downstream analysis section, we outline further options for analysing your data.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	10–20 fmol of good quality library can be loaded on to a MinION/GridION flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Native Barcoding Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FCT tube). Make sure FCT was added to FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	Fast fuel consumption is typically seen in Kit 9 chemistry (e.g. SQK-LSK109) when the flow cell is overloaded with library. Please see the appropriate protocol for your DNA library to find the recommendation.	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.