Ligation sequencing V14 - PCR barcoding (SQK-LSK114 with EXP-PBC001 or EXP-PBC096)

Version for device: MinION

1. PCR Barcoding Expansion features:

   We have two PCR barcoding expansions available depending on the number of barcodes required:

   • PCR Barcoding Expansion 1-12 (EXP-PBC001): up to 12 unique barcodes are available
   • PCR Barcoding Expansion 1-96 (EXP-PBC096): up to 96 unique barcodes are available

   
   
   These expansions are used with the Ligation Sequencing Kit V14 and recommended for users who:

   • Want to multiplex up to 12 or 96 barcodes, depending on the expansion they are using.
   • Would like to achieve raw read sequencing modal accuracy of Q20+ (99%) or above.
   • Want to optimise their sequencing experiment for output.
   • Require control over read length.
   • Would like to utilise upstream processes such as size selection or whole genome amplification.
2. Introduction to the PCR Barcoding protocol

   This protocol describes how to carry out PCR barcoding of gDNA using the Ligation Sequencing Kit V14 (SQK-LSK114) with the PCR Barcoding Expansion Pack 1-12 (EXP-PBC001) or 1-96 (EXP-PBC096). This protocol also outlines recommendations to PCR barcode amplicons. Using the PCR Barcoding expansions allows for up to either 12 or 96 samples to be combined and loaded onto a single flow cell. It is highly recommended that a Lambda control experiment is completed first to become familiar with the technology.

   Note: For amplicon inputs, first-round PCR product with the following tailed primers are required.
   5’ TTTCTGTTGGTGCTGATATTGC-[ project-specific forward primer sequence ] 3’
   5’ ACTTGCCTGTCGCTCTATCTTC-[ project-specific reverse primer sequence ] 3’

   Steps in the sequencing workflow:

   Prepare for your experiment
   You will need to:

   • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success
   • Ensure you have your sequencing kit, the correct equipment and third-party reagents
   • Download the software for acquiring and analysing your data
   • Check your flow cell to ensure it has enough pores for a good sequencing run
     

   
   

   Experiment workflow

   The table below is an overview of the steps required in the sample and library preparation, including timings and optional stopping points.

   Library preparation	Process	Time	Stop option
   For gDNA: DNA end-prep or For amplicons: Incorporate tailed primers	Prepare the DNA ends for PCR adapter attachment or Perform a round of PCR to incoporate tailed primers	35 minutes	4°C overnight
   For gDNA: attach barcoding adapters or For amplicons: second round of PCR to incorporate barcode sequences	Attach barcoding adapters to the DNA ends. or Complete a second round of PCR to incorporate the Oxford Nanopore barcode sequences.	40 minutes	4°C overnight
   Amplify and pool samples	Amplify each barcoded sample by PCR, then pool the samples together.	15 minutes + Adjustable PCR time	4°C overnight
   End-prep	Repair the DNA and prepare the DNA ends for adapter attachment	35 minutes	4°C overnight
   Adapter ligation and clean-up	Attach the sequencing adapters to the DNA ends	20 minutes	4°C short-term storage or for repeated use, such as re-loading your flow cell -80°C for single-use, long-term storage. We strongly recommend sequencing your library as soon as it is adapted.
   Priming and loading the flow cell	Prime the flow cell and load the prepared library for sequencing	5 minutes

   

   Sequencing and analysis

   You will need to:

   • In the current MinKNOW software version, the PCR Barcoding Expansions are not available in "Kit selection" when setting up a sequencing run. These will be included in the next software update. For the meantime, we recommend the following:
     • Start a sequencing run in the MinKNOW software using SQK-LSK114, which will collect raw data from the device and convert it into basecalled reads.
     • Demultiplex your data post-run on MinKNOW using the barcoding option, choosing either EXP-PBC001 or EXP-PBC096 as your barcoding kit. Further information is available in the "Post-run barcoding" of the MinKNOW protocol.
   • Start the EPI2ME software and select the barcoding workflow for further analysis (this step is optional).
3. Important We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.
4. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • PCR Barcoding Expansion Pack 1-12 (EXP-PBC001)
   • PCR Barcoding Expansion Pack 1-96 (EXP-PBC096)
   • Ligation Sequencing Kit V14 (SQK-LSK114)
   • R10.4.1 MinION Flow Cells (FLO-MIN114)
   • Flow Cell Wash Kit (EXP-WSH004)
   • Control Expansion (EXP-CTL001)
   • Flow Cell Priming Kit V14 (EXP-FLP004)
   • MinION Mk1B - MinION Mk1B IT requirements document
   • MinION Mk1C - MinION Mk1C IT requirements document
   • GridION - GridION IT requirements document

1. 100 ng of gDNA is required per sample.

   If using amplicons, 100 ng of first-round PCR product (with tailed primers) is required per sample.

2. Important Fragmentation and size selection

   For successful amplification, it is critical that the DNA fragment distribution of templates used in the PCR are <8 Kbp. If the input DNA is not < Kbp, use follow steps outline in Shearing genomic DNA using the Covaris g-TUBE™ to shear the sample to each a fragment distribution <8 Kbp.

   Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments. Instructions are available in the Size Selection section of Extraction methods.

3. Input DNA

   How to QC your input DNA

   It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

   For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

   Chemical contaminants

   Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

4. Third-party reagents

   We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

   For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

5. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

6. Important AMPure XP Beads

   Within the Ligation Sequencing Kit V14 (SQK-LSK114), AMPure XP Beads (AXP) are supplied at the volume needed to complete the "End-prep" and "Adapter ligation and clean up" steps of the protocol. However, for initially preparing the sample ends and the PCR steps, extra AMPure XP Beads are required for purification and clean-up. Please note, other purification methods are available.

7. Ligation Sequencing Kit V14 (SQK-LSK114) contents

   Note: We are in the process of reformatting our kits with single-use tubes into a bottle format.

   Single-use tubes format:
   

   Bottle format:
   

   Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

   Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.

8. PCR Barcoding Expansion 1-12 (EXP-PBC001) contents

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   PCR Barcode 1-12	BC1-12	Clear	12	20
   Barcode Adapter	BCA	Blue stripe	1	260

9. PCR Barcoding Expansion Pack 1-96 (EXP-PBC096)

   

   Name	Acronym	Cap colour	No. of vials/plates	Fill volume per well (µl)
   PCR Barcode Primer Mix plate	BC01-96	White	1 plate	24
   Barcode Adapter plate	BCA	Blue	1 plate	240

10. Layout of barcodes in the 96 tube plate

    The wells of the 96 tube plate correspond to the barcodes in the following way. All barcodes are supplied at 10 µM concentration and to be used at a final concentration of 0.2 µM.

    

11. Capping and decapping the 96 well format

    

12. 96 barcode sequences

    Component	Sequence
    BC01 / RB01	AAGAAAGTTGTCGGTGTCTTTGTG
    BC02 / RB02	TCGATTCCGTTTGTAGTCGTCTGT
    BC03 / RB03	GAGTCTTGTGTCCCAGTTACCAGG
    BC04 / RB04	TTCGGATTCTATCGTGTTTCCCTA
    BC05 / RB05	CTTGTCCAGGGTTTGTGTAACCTT
    BC06 / RB06	TTCTCGCAAAGGCAGAAAGTAGTC
    BC07 / RB07	GTGTTACCGTGGGAATGAATCCTT
    BC08 / RB08	TTCAGGGAACAAACCAAGTTACGT
    BC09 / RB09	AACTAGGCACAGCGAGTCTTGGTT
    BC10 / RB10	AAGCGTTGAAACCTTTGTCCTCTC
    BC11 / RB11	GTTTCATCTATCGGAGGGAATGGA
    BC12 / RB12	CAGGTAGAAAGAAGCAGAATCGGA
    BC13 / 16S13 / RB13	AGAACGACTTCCATACTCGTGTGA
    BC14 / 16S14 / RB14	AACGAGTCTCTTGGGACCCATAGA
    BC15 / 16S15 / RB15	AGGTCTACCTCGCTAACACCACTG
    BC16 / 16S16 / RB16	CGTCAACTGACAGTGGTTCGTACT
    BC17 / 16S17 / RB17	ACCCTCCAGGAAAGTACCTCTGAT
    BC18 / 16S18 / RB18	CCAAACCCAACAACCTAGATAGGC
    BC19 / 16S19 / RB19	GTTCCTCGTGCAGTGTCAAGAGAT
    BC20 / 16S20 / RB20	TTGCGTCCTGTTACGAGAACTCAT
    BC21 / 16S21 / RB21	GAGCCTCTCATTGTCCGTTCTCTA
    BC22 / 16S22 / RB22	ACCACTGCCATGTATCAAAGTACG
    BC23 / 16S23 / RB23	CTTACTACCCAGTGAACCTCCTCG
    BC24 / 16S24 / RB24	GCATAGTTCTGCATGATGGGTTAG
    BC25 / RB25	GTAAGTTGGGTATGCAACGCAATG
    BC26 / RB26	CATACAGCGACTACGCATTCTCAT
    BC27 / RB27	CGACGGTTAGATTCACCTCTTACA
    BC28 / RB28	TGAAACCTAAGAAGGCACCGTATC
    BC29 / RB29	CTAGACACCTTGGGTTGACAGACC
    BC30 / RB30	TCAGTGAGGATCTACTTCGACCCA
    BC31 / RB31	TGCGTACAGCAATCAGTTACATTG
    BC32 / RB32	CCAGTAGAAGTCCGACAACGTCAT
    BC33 / RB33	CAGACTTGGTACGGTTGGGTAACT
    BC34 / RB34	GGACGAAGAACTCAAGTCAAAGGC
    BC35 / RB35	CTACTTACGAAGCTGAGGGACTGC
    BC36 / RB36	ATGTCCCAGTTAGAGGAGGAAACA
    BC37 / RB37	GCTTGCGATTGATGCTTAGTATCA
    BC38 / RB38	ACCACAGGAGGACGATACAGAGAA
    BC39 / RB39	CCACAGTGTCAACTAGAGCCTCTC
    BC40 / RB40	TAGTTTGGATGACCAAGGATAGCC
    BC41 / RB41	GGAGTTCGTCCAGAGAAGTACACG
    BC42 / RB42	CTACGTGTAAGGCATACCTGCCAG
    BC43 / RB43	CTTTCGTTGTTGACTCGACGGTAG
    BC44 / RB44	AGTAGAAAGGGTTCCTTCCCACTC
    BC45 / RB45	GATCCAACAGAGATGCCTTCAGTG
    BC46 / RB46	GCTGTGTTCCACTTCATTCTCCTG
    BC47 / RB47	GTGCAACTTTCCCACAGGTAGTTC
    BC48 / RB48	CATCTGGAACGTGGTACACCTGTA
    BC49 / RB49	ACTGGTGCAGCTTTGAACATCTAG
    BC50 / RB50	ATGGACTTTGGTAACTTCCTGCGT
    BC51 / RB51	GTTGAATGAGCCTACTGGGTCCTC
    BC52 / RB52	TGAGAGACAAGATTGTTCGTGGAC
    BC53 / RB53	AGATTCAGACCGTCTCATGCAAAG
    BC54 / RB54	CAAGAGCTTTGACTAAGGAGCATG
    BC55 / RB55	TGGAAGATGAGACCCTGATCTACG
    BC56 / RB56	TCACTACTCAACAGGTGGCATGAA
    BC57 / RB57	GCTAGGTCAATCTCCTTCGGAAGT
    BC58 / RB58	CAGGTTACTCCTCCGTGAGTCTGA
    BC59 / RB59	TCAATCAAGAAGGGAAAGCAAGGT
    BC60 / RB60	CATGTTCAACCAAGGCTTCTATGG
    BC61 / RB61	AGAGGGTACTATGTGCCTCAGCAC
    BC62 / RB62	CACCCACACTTACTTCAGGACGTA
    BC63 / RB63	TTCTGAAGTTCCTGGGTCTTGAAC
    BC64 / RB64	GACAGACACCGTTCATCGACTTTC
    BC65 / RB65	TTCTCAGTCTTCCTCCAGACAAGG
    BC66 / RB66	CCGATCCTTGTGGCTTCTAACTTC
    BC67 / RB67	GTTTGTCATACTCGTGTGCTCACC
    BC68 / RB68	GAATCTAAGCAAACACGAAGGTGG
    BC69 / RB69	TACAGTCCGAGCCTCATGTGATCT
    BC70 / RB70	ACCGAGATCCTACGAATGGAGTGT
    BC71 / RB71	CCTGGGAGCATCAGGTAGTAACAG
    BC72 / RB72	TAGCTGACTGTCTTCCATACCGAC
    BC73 / RB73	AAGAAACAGGATGACAGAACCCTC
    BC74 / RB74	TACAAGCATCCCAACACTTCCACT
    BC75 / RB75	GACCATTGTGATGAACCCTGTTGT
    BC76 / RB76	ATGCTTGTTACATCAACCCTGGAC
    BC77 / RB77	CGACCTGTTTCTCAGGGATACAAC
    BC78 / RB78	AACAACCGAACCTTTGAATCAGAA
    BC79 / RB79	TCTCGGAGATAGTTCTCACTGCTG
    BC80 / RB80	CGGATGAACATAGGATAGCGATTC
    BC81 / RB81	CCTCATCTTGTGAAGTTGTTTCGG
    BC82 / RB82	ACGGTATGTCGAGTTCCAGGACTA
    BC83 / RB83	TGGCTTGATCTAGGTAAGGTCGAA
    BC84 / RB84	GTAGTGGACCTAGAACCTGTGCCA
    BC85 / RB85	AACGGAGGAGTTAGTTGGATGATC
    BC86 / RB86	AGGTGATCCCAACAAGCGTAAGTA
    BC87 / RB87	TACATGCTCCTGTTGTTAGGGAGG
    BC88 / RB88	TCTTCTACTACCGATCCGAAGCAG
    BC89 / RB89	ACAGCATCAATGTTTGGCTAGTTG
    BC90 / RB90	GATGTAGAGGGTACGGTTTGAGGC
    BC91 / RB91	GGCTCCATAGGAACTCACGCTACT
    BC92 / RB92	TTGTGAGTGGAAAGATACAGGACC
    BC93 / RB93	AGTTTCCATCACTTCAGACTTGGG
    BC94 / RB94	GATTGTCCTCAAACTGCCACCTAC
    BC95 / RB95	CCTGTCTGGAAGAAGAATGGACTT
    BC96 / RB96	CTGAACGGTCATAGAGTCCACCAT

1. Check your flow cell.

   We recommend performing a flow cell check before starting your library prep to ensure you have a flow cell with enough pores for a good sequencing run.

   See the flow cell check instructions in the MinKNOW protocol for more information.

2. Prepare the NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer's instructions, and place on ice:

   For optimal performance, NEB recommend the following:

   1. Thaw all reagents on ice.

   2. Ensure the reagents are well mixed.
      
      Note: Do not vortex the Ultra II End Prep Enzyme Mix.

   3. Always spin down tubes before opening for the first time each day.

   4. The NEBNext Ultra II End Prep Reaction Buffer may contain a white precipitate. If this occurs, allow the mixture(s) to come to room temperature and pipette the buffer several times to break up the precipitate, followed by a quick vortex to mix.

3. Prepare the DNA in nuclease-free water.
   1. Transfer 100 ng DNA of each sample into a fresh 0.2 ml PCR tube or plate
   2. Adjust the volume to 45 μl with nuclease-free water
   3. Mix thoroughly by flicking the tube to avoid unwanted shearing
   4. Spin down briefly in a microfuge

4. Set up the end-repair reaction as follows for each library:

   Reagent	Volume per sample
   100 ng DNA	45 µl
   Ultra II End-prep reaction buffer	7 µl
   Ultra II End-prep enzyme mix	3 µl
   Nuclease-free water	5 µl
   Total	60 µl

5. Mix by pipetting and briefly spin down.
6. Using a thermal cycler, incubate for 5 minutes at 20 °C and 5 minutes at 65 °C.
7. Resuspend the AMPure XP beads by vortexing.
8. Add 60 µl of resuspended AMPure XP beads to the end-prep reaction and mix by pipetting.
9. Incubate at room temperature for 5 minutes.
10. Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per sample, with some excess.
11. Spin down the samples and pellet on a magnet until supernatant is clear and colourless. Keep the samples on the magnet, and pipette off the supernatant.
12. Keep the samples on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
13. Repeat the previous step.
14. Spin down and place the samples back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
15. Remove the samples from the magnet and resuspend each pellet in 16 µl nuclease-free water. Incubate for 2 minutes at room temperature.
16. Pellet the beads on a magnet until the eluate is clear and colourless.
17. Remove eluate once it is clear and colourless. Transfer each eluted sample to a new tube or plate well.
18. Quantify 1 µl of end-prepped DNA using a Qubit fluorometer.
19. End of Step Take forward the end-prepped DNA into the next step. However, at this point it is also possible to store the sample at 4°C overnight.

1. Prepare the NEB Blunt/TA Ligase Master Mix according to the manufacturer's instructions, and place on ice:

   1. Thaw the reagents at room temperature.

   2. Spin down the reagent tubes for 5 seconds.

   3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.

2. Spin down the Barcode Adapter (BCA), pipette mix and place on ice.
3. Add the reagents in the order given below, into fresh 0.2 ml PCR tubes or 96-well plate:

   Reagent	Volume
   End-prepped DNA	15 µl
   Barcode Adapter	10 µl
   Blunt/TA Ligase Master Mix	25 µl
   Total	50 µl

4. Mix by pipetting and briefly spin down.
5. Incubate the samples for 10 minutes at room temperature.
6. Resuspend the AMPure XP beads by vortexing.
7. Add 20 µl of resuspended AMPure XP beads to each sample for a 0.4X clean and mix by pipetting up and down ten times.
8. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
9. Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per sample, with some excess.
10. Place on a magnetic rack, allow beads to pellet and pipette off supernatant.
11. Keep the samples on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
12. Repeat the previous step.
13. Place the samples back on the magnet. Pipette off any residual 80% ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
14. Remove the samples from the magnet and resuspend pellet in 25 µl nuclease-free water. Incubate for 2 minutes at room temperature.
15. Pellet the beads on a magnet until the eluate is clear and colourless.
16. Remove and retain the eluate once it is clear and colourless. Transfer each eluted sample to a fresh 0.2 ml PCR tube or plate.
    • Dispose of the pelleted beads.

17. Quantify 1 µl of the adapter ligated DNA using a Qubit fluorometer.
18. End of Step Take forward the adapter ligated samples into the Barcoding PCR step. However, at this point it is also possible to store the sample at 4°C overnight.

1. Please note, this protocol is written for a template input of 100–200 fmol with PCR Barcodes (BC01-96) used at a final concentration of 0.2 µM. However, the input mass and the number of PCR cycles may be adjusted as appropriate depending on the requirements of the experiment.
2. Thaw the PCR Barcodes (BC01-96) required for your number of samples at room temperature. Individually mix the barcodes by pipetting, spin down, and place on ice.
3. Important If using amplicon samples, ensure the samples have undergone a round of PCR with tailed primers before commencing with the protocol.
4. Prepare the samples in nuclease-free water:
   1. Transfer 100-200 fmol of each sample to a clear 0.2 ml PCR tube or plate
      
      • For 1–12 samples: Adjust the volume to 48 μl with nuclease-free water
      • For 13–96 samples: Adjust the volume to 24 μl with nuclease-free water
        
   2. Mix thoroughly by flicking the tube or plate to avoid unwanted shearing
   3. Spin down briefly in a microfuge

5. Select a unique barcode for each sample to be run together on the same flow cell.

   Note: Only use one barcode per sample.

6. Set up a barcoding PCR reaction as follows for each library in fresh 0.2 ml PCR tubes or plate:

   Between each addition, pipette mix 10-20 times.

   Reagent	Volume per sample for using 1–12 barcodes	Volume per sample for using 13 barcodes or more
   PCR Barcode (one of BC1-BC96, at 10 µM)	2 µl	1 µl
   Adapter ligated DNA or amplicons with tailed primers	48 µl	24 µl
   HotStart LongAmp Taq 2x master mix	50 µl	25 µl
   Total volume	100 µl	50 µl

   If the amount of input material is altered, the number of PCR cycles may need to be adjusted to produce the same yield.

7. Mix by pipetting and briefly spin down.
8. Amplify using the following cycling conditions:

   Cycle step	Temperature	Time	No. of cycles
   Initial denaturation	94 °C	3 mins	1
   Denaturation	94 °C	15 secs	15-18 (a)
   Annealing	56 °C	15 secs	15-18 (a)
   Extension	65 °C	6 mins (b)	15-18 (a)
   Final extension	65 °C	10 mins	1
   Hold	4 °C	∞

   a. Adjust accordingly if input quantities are altered.

   b. Adjust accordingly for different lengths of amplicons and the type of polymerase that is being used (LongAmp Taq amplifies at a rate of 50 seconds per kb). Here 6 min is used for ~8 Kbp templates.

9. Resuspend the AMPure XP beads by vortexing.
10. Add 0.4X volume of resuspended AMPure XP Beads to each reaction and mix by flicking the tube.

    Reagent	Volume for 100 µl samples	Volume for 50 µl samples
    AMPure XP Beads	40 µl	20 µl

11. Incubate at room temperature for 5 minutes.
12. Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per sample, with some excess.
13. Place on a magnetic rack, allow beads to pellet and pipette off supernatant.
14. Keep the samples on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellets. Remove the ethanol using a pipette and discard.
15. Repeat the previous step.
16. Spin down and place the samples back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellets to the point of cracking.
17. Remove the samples from the magnetic rack and resuspend each pellet in 25 µl nuclease-free water. Incubate for 2 minutes at room temperature.
18. Pellet the beads on a magnetic rack until the eluate is clear and colourless.
19. Remove and retain 25 µl of each eluate into clean 0.2 ml PCR tubes or plate.

    Dispose of the pelleted beads

20. Quantify the barcoded library using a Qubit fluorometer and pool all barcoded libraries in the desired ratios in a 1.5 ml DNA LoBind Eppendorf tube.
21. Gel analysis of amplified and ligated DNA

    Sometimes a high-molecular weight product is visible in the wells of the gel when the PCR products are run, instead of the expected smear. These libraries are typically associated with poor sequencing performance. We have found that repeating the PCR with fewer cycles can remedy this.

22. Prepare 1 µg of pooled barcoded libraries in 50 µl nuclease-free water.

    If the volume of your pool exceeds the 50 µl required for the end-prep reaction, consider a 2.5X AMPure XP Bead purification of the pool to concentrate your sample.

23. End of Step This pooled library is now ready to be end-repaired and adapted for sequencing. However, at this point it is also possible to store the sample at 4°C overnight.

1. Prepare the NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer's instructions, and place on ice:

   For optimal performance, NEB recommend the following:

   1. Thaw all reagents on ice.

   2. Ensure the reagents are well mixed.
      
      Note: Do not vortex the Ultra II End Prep Enzyme Mix.

   3. Always spin down tubes before opening for the first time each day.

   4. The NEBNext Ultra II End Prep Reaction Buffer may contain a white precipitate. If this occurs, allow the mixture(s) to come to room temperature and pipette the buffer several times to break up the precipitate, followed by a quick vortex to mix.

2. Prepare the PCR amplified DNA in nuclease-free water
   1. Transfer 1 ug genomic DNA into a 0.2 ml thin-walled PCR tube.
   2. Adjust the volume to 50 μl with nuclease-free water.
   3. Mix thoroughly by flicking the tube to avoid unwanted shearing.
   4. Spin down briefly in a microfuge.

3. In a 0.2 ml thin-walled PCR tube, mix the following:

   Reagent	Volume
   DNA	50 µl
   Ultra II End-prep Reaction Buffer	7 µl
   Ultra II End-prep Enzyme Mix	3 µl
   Total	60 µl

4. Thoroughly mix the reaction by gently pipetting and briefly spinning down.
5. Using a thermal cycler, incubate at 20°C for 5 minutes and 65°C for 5 minutes.
6. Resuspend the AMPure XP Beads (AXP) by vortexing.
7. Transfer the DNA sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
8. Add 60 µl of resuspended the AMPure XP Beads (AXP) to the end-prep reaction and mix by flicking the tube.
9. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
10. Prepare 500 μl of fresh 80% ethanol in nuclease-free water.
11. Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.
12. Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
13. Repeat the previous step.
14. Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
15. Remove the tube from the magnetic rack and resuspend the pellet in 61 µl nuclease-free water. Incubate for 2 minutes at room temperature.
16. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
17. Remove and retain 61 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
18. Quantify 1 µl of eluted sample using a Qubit fluorometer.
19. End of Step Take forward the repaired and end-prepped DNA into the adapter ligation step. However, at this point it is also possible to store the sample at 4°C overnight.

1. Tip We recommend using the Salt-T4® DNA Ligase (NEB, M0467).

   Salt-T4® DNA Ligase (NEB, M0467) can be bought separately or is provided in the NEBNext® Companion Module v2 for Oxford Nanopore Technologies® Ligation Sequencing (catalogue number E7672S or E7672L).

   The Quick T4 DNA Ligase (NEB, E6057) available in the previous version NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing (NEB, E7180S or E7180L) is also compatible, but the new recommended reagent offers more efficient and ligation.

2. Important Although third-party ligase products may be supplied with their own buffer, the ligation efficiency of the Ligation Adapter (LA) is higher when using the Ligation Buffer (LNB) supplied in the Ligation Sequencing Kit.
3. Spin down the Ligation Adapter (LA) and Salt-T4® DNA Ligase, and place on ice.
4. Thaw Ligation Buffer (LNB) at room temperature, spin down and mix by pipetting. Due to viscosity, vortexing this buffer is ineffective. Place on ice immediately after thawing and mixing.
5. Thaw the Elution Buffer (EB) at room temperature and mix by vortexing. Then spin down and place on ice.
6. Important Depending on the wash buffer (LFB or SFB) used, the clean-up step after adapter ligation is designed to either enrich for DNA fragments of >3 kb, or purify all fragments equally.
   • To enrich for DNA fragments of 3 kb or longer, use Long Fragment Buffer (LFB)
   • To retain DNA fragments of all sizes, use Short Fragment Buffer (SFB)
7. Thaw either Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB) at room temperature and mix by vortexing. Then spin down and place on ice.
8. In a 1.5 ml Eppendorf DNA LoBind tube, mix in the following order:

   Between each addition, pipette mix 10-20 times.

   Reagent	Volume
   DNA sample from the previous step	60 µl
   Ligation Adapter (LA)	5 µl
   Ligation Buffer (LNB)	25 µl
   Salt-T4® DNA Ligase	10 µl
   Total	100 µl

9. Thoroughly mix the reaction by gently pipetting and briefly spinning down.
10. Incubate the reaction for 10 minutes at room temperature.
11. Resuspend the AMPure XP Beads (AXP) by vortexing.
12. Add 40 µl of resuspended AMPure XP Beads (AXP) to the reaction and mix by flicking the tube.
13. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
14. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
15. Wash the beads by adding either 250 μl Long Fragment Buffer (LFB) or 250 μl Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.
16. Repeat the previous step.
17. Spin down and place the tube back on the magnet. Pipette off any residual supernatant. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
18. Remove the tube from the magnetic rack and resuspend the pellet in 15 µl Elution Buffer (EB). Spin down and incubate for 10 minutes at room temperature. For high molecular weight DNA, incubating at 37°C can improve the recovery of long fragments.
19. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
20. Remove and retain 15 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

    Dispose of the pelleted beads

21. Quantify 1 µl of eluted sample using a Qubit fluorometer.
22. Depending on your DNA library fragment size, prepare your final library in 12 µl of Elution Buffer (EB).

    Fragment library length	Flow cell loading amount
    Very short (<1 kb)	100 fmol
    Short (1-10 kb)	35–50 fmol
    Long (>10 kb)	300 ng

    Note: If the library yields are below the input recommendations, load the entire library.

    If required, we recommend using a mass to mol calculator such as the NEB calculator.

23. End of Step The prepared library is used for loading into the flow cell. Store the library on ice or at 4°C until ready to load.
24. Tip Library storage recommendations

    We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short-term storage or repeated use, for example, re-loading flow cells between washes.
    For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

1. Important Please note, this kit is only compatible with R10.4.1 flow cells (FLO-MIN114).
2. Tip Priming and loading a flow cell

   We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

3. Thaw the Sequencing Buffer (SB), Library Beads (LIB) or Library Solution (LIS, if using), Flow Cell Tether (FCT) and Flow Cell Flush (FCF) at room temperature before mixing by vortexing. Then spin down and store on ice.
4. Important For optimal sequencing performance and improved output on MinION R10.4.1 flow cells (FLO-MIN114), we recommend adding Bovine Serum Albumin (BSA) to the flow cell priming mix at a final concentration of 0.2 mg/ml.

   Note: We do not recommend using any other albumin type (e.g. recombinant human serum albumin).

5. To prepare the flow cell priming mix with BSA, combine Flow Cell Flush (FCF) and Flow Cell Tether (FCT), as directed below. Mix by pipetting at room temperature.

   Note: We are in the process of reformatting our kits with single-use tubes into a bottle format. Please follow the instructions for your kit format.

   Single-use tubes format:
   Add 5 µl Bovine Serum Albumin (BSA) at 50 mg/ml and 30 µl Flow Cell Tether (FCT) directly to a tube of Flow Cell Flush (FCF).

   Bottle format:
   In a suitable tube for the number of flow cells, combine the following reagents:

   Reagent	Volume per flow cell
   Flow Cell Flush (FCF)	1,170 µl
   Bovine Serum Albumin (BSA) at 50 mg/ml	5 µl
   Flow Cell Tether (FCT)	30 µl
   Total volume	1,205 µl

6. Open the MinION or GridION device lid and slide the flow cell under the clip. Press down firmly on the flow cell to ensure correct thermal and electrical contact.

   

   

7. Optional Action

   Complete a flow cell check to assess the number of pores available before loading the library.

   This step can be omitted if the flow cell has been checked previously.

   See the flow cell check instructions in the MinKNOW protocol for more information.

8. Slide the flow cell priming port cover clockwise to open the priming port.

   

9. Important Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
10. After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
    1. Set a P1000 pipette to 200 µl
    2. Insert the tip into the priming port
    3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
       

    Note: Visually check that there is continuous buffer from the priming port across the sensor array.

    

11. Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

    

12. Thoroughly mix the contents of the Library Beads (LIB) by pipetting.
13. Important The Library Beads (LIB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

    We recommend using the Library Beads (LIB) for most sequencing experiments. However, the Library Solution (LIS) is available for more viscous libraries.

14. In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:

    Reagent	Volume per flow cell
    Sequencing Buffer (SB)	37.5 µl
    Library Beads (LIB) mixed immediately before use, or Library Solution (LIS), if using	25.5 µl
    DNA library	12 µl
    Total	75 µl

15. Complete the flow cell priming:
    1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
    2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

    

    

16. Mix the prepared library gently by pipetting up and down just prior to loading.
17. Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

    

18. Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

    

    

19. Important Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

    We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

20. Place the light shield onto the flow cell, as follows:

    1. Carefully place the leading edge of the light shield against the clip.
       Note: Do not force the light shield underneath the clip.

    2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

    

21. Caution The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
22. End of Step Close the device lid and set up a sequencing run on MinKNOW.

1. Overview of nanopore data analysis

   For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

2. How to start sequencing

   The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software.Please ensure MinKNOW is installed on your computer or device. Further instructions for setting up a sequencing run can be found in the MinKNOW protocol.

   In the current MinKNOW software version, the PCR Barcoding Expansions are not available in "Kit selection" when setting up a sequencing run. These will be included in the next software update.

   For the meantime, we recommend starting a sequencing run in the MinKNOW software using Ligation Sequencing Kit V14 (SQK-LSK114) to perform real-time basecalling. Once basecalling is complete, the data can be demultiplexed using post-run barcoding on MinKNOW, as outlined below.

3. MinKNOW settings for real-time basecalling and post-run barcoding:

   Real-time basecalling

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section for your device until the end of the "Completing a MinKNOW run" section.

   Select Ligation Sequencing Kit (SQK-LSK114) in "Kit selection". The barcoding option will be unavailable as default. Other parameters can be kept at their default settings.

   

   Post-run barcoding

   Follow the instructions in "Post-run barcoding" of the MinKNOW protocol.

   Click Analysis to open post-run options. Choose Barcoding and input your fastq data files. Select the PCR Barcoding Expansion used during library preparation in "Barcode settings" and use the default settings for other parameters.

   

   

1. Post-basecalling analysis

   There are several options for further analysing your basecalled data:

   1. EPI2ME workflows

   For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME, which are available in the EPI2ME section of the Community. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

   2. Research analysis tools

   Oxford Nanopore Technologies' Research division has created a number of analysis tools, that are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

   3. Community-developed analysis tools

   If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

1. After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at 2-8°C.

   The Flow Cell Wash Kit protocol is available on the Nanopore Community.

2. Tip We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
3. Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.

   Instructions for returning flow cells can be found here.

   Note: All flow cells must be flushed with deionised water before returning the product.

4. Important If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure the correct volume and concentration as stated on the appropriate protocol for your sequencing library is loaded onto the flow cell. Please quantify the library before loading and calculate fmols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to fmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT tube for Kit 9, 10, 11, FCT for Kit 14, and FTU for ultra-long DNA kits). Make sure FLT/FCT/FTU was added to the buffer (FB for Kit 9, 10, 11, and FCF for Kit 14) before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

9. Failed to reach target temperature

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.