PCR tiling of SARS-CoV-2 virus - Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001)

Version for device: MinION

1. Important This protocol is a work in progress and some details are expected to change over time. Please make sure you always use the most recent version of the protocol.

   The PCR tiling of SARS-CoV-2 virus with Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001) protocol is an updated version of the PCR tiling of SARS-CoV-2 virus with rapid barcoding and Midnight RT PCR Expansion (SQK-RBK110.96 and EXP-MRT001) using our most recent Kit 14 chemistry and an updated downstream analysis.

2. Introduction to the protocol

   To enable support for the rapidly expanding user requests, the team at Oxford Nanopore Technologies have put together an updated workflow based on the ARTIC Network protocols and analysis methods. The protocol uses Oxford Nanopore Technologies' Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) and Midnight RT PCR Expansion (EXP-MRT001) for barcoding and library preparation.

   While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the members of the ARTIC network who have been behind the development of these methods.

   This protocol is similar to the ARTIC amplicon sequencing protocol for MinION for SARS-CoV-2 v3 (LoCost) by Josh Quick and the method used in Freed et al., 2020. The protocol generates amplicons in a tiled fashion across the whole SARS-CoV-2 genome.

   To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA for use with the Rapid Barcoding Kit 96 V14 (SQK-RBK114.96), primers were designed by Freed et al., 2020 using Primal Scheme. These primers are in the Midnight RT PCR Expansion (EXP-MRT001) and are designed to generate 1.2 kb amplicons. Primer sequences can be found here.

   As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.

   Steps in the sequencing workflow:

   Prepare for your experiment
   you will need to:

   • Extract your RNA
   • Ensure you have your sequencing kit, the correct equipment and reagents
   • Download the software for acquiring and analysing your data
   • Check your flow cell to ensure it has enough pores for a good sequencing run

   
   

   Prepare your library
   You will need to:

   • Reverse transcribe your RNA samples with random hexamers
   • Amplify the samples by tiled PCR using separate primer pools
   • Combine the primer pools
   • Attach Rapid Barcodes supplied in the kit to the DNA ends, pool the samples and SPRI purify
   • Prime the flow cell and load your DNA library into the flow cell

   

   Sequencing and analysis
   You will need to:

   • Start a sequencing run using the MinKNOW software, selecting SQK-RBK114.96 in kit selection, which will collect raw data from the device and convert it into basecalled reads
   • (Optional): Perform downstream analysis of the data using the wf-artic analysis workflow integrated within the EPI2ME Labs application
3. Before starting

   This protocol outlines how to carry out PCR tiling of SARS-CoV-2 viral RNA samples on a 96-well plate using the Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) with the Midnight RT PCR Expansion (EXP-MRT001).

   It is required to use total RNA extracted from samples that have been screened by a suitable qPCR assay.

   When processing multiple samples at once, we recommend making master mixes with an additional 10% of the volume. We also recommend using a template-free pre-PCR hood for making up the master mixes, and a separate template pre-PCR hood for handling the samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.

   All post-PCR procedures must be carried out in a separate area to the pre-PCR preparation, with dedicated equipment for liquid handling in each area.

4. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • Rapid Barcoding Kit 96 V14 (SQK-RBK114.96)
   • Midnight RT PCR Expansion (EXP-MRT001)
   • R10.4.1 flow cells (FLO-MIN114)
   • Flow Cell Wash Kit (EXP-WSH004)

1. For this protocol, you will need your extracted RNA in 8 µl 10 mM Tris-HCl, pH 8.0.
2. Important The Rapid Adapter (RA) used in this kit and protocol is not interchangeable with other sequencing adapters.
3. Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) contents

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
   Rapid Adapter	RA	Green	2	15
   Adapter Buffer	ADB	Clear	1	100
   AMPure XP Beads	AXP	Amber	3	1,200
   Elution Buffer	EB	Black	1	1,500
   Sequencing Buffer	SB	Red	1	1,700
   Library Beads	LIB	Pink	1	1,800
   Library Solution	LIS	White cap, pink label	1	1,800
   Flow Cell Flush	FCF	Clear	1	15,500
   Flow Cell Tether	FCT	Purple	2	200
   Rapid Barcodes	RB01-96	-	3 plates	8 µl per well

   This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

4. Midnight RT PCR Expansion (EXP-MRT001) contents

   

   Name	Acronym	Cap colour	Number of vials	Fill volume per vial (µl)
   LunaScript RT SuperMix	LS RT	Blue	3	500
   Q5 HS Master Mix	Q5	Orange	6	1,500
   Midnight Primer Pool A	MP A	White	3	15
   Midnight Primer Pool B	MP B	Clear	3	15

5. Midnight Primer sequences

   As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.

   Below are the sequences for the V3 primer scheme used in the Midnight RT PCR Expansion.

   Pool A

   Primer name	Primer Sequence
   SARSCoV_1200_1_LEFT	ACCAACCAACTTTCGATCTCTTGT
   SARSCoV_1200_1_RIGHT	GGTTGCATTCATTTGGTGACGC
   SARSCoV_1200_3_LEFT	GGCTTGAAGAGAAGTTTAAGGAAGGT
   SARSCoV_1200_3_RIGHT	GATTGTCCTCACTGCCGTCTTG
   SARSCoV_1200_5_LEFT	ACCTACTAAAAAGGCTGGTGGC
   SARSCoV_1200_5_RIGHT	AGCATCTTGTAGAGCAGGTGGA
   SARSCoV_1200_7_LEFT	ACCTGGTGTATACGTTGTCTTTGG
   SARSCoV_1200_7_RIGHT	GCTGAAATCGGGGCCATTTGTA
   SARSCoV_1200_9_LEFT	AGAAGTTACTGGCGATAGTTGTAATAACT
   SARSCoV_1200_9_RIGHT	TGCTGATATGTCCAAAGCACCA
   SARSCoV_1200_11_LEFT	AGACACCTAAGTATAAGTTTGTTCGCA
   SARSCoV_1200_11_RIGHT	GCCCACATGGAAATGGCTTGAT
   SARSCoV_1200_13_LEFT	ACCTCTTACAACAGCAGCCAAAC
   SARSCoV_1200_13_RIGHT	CGTCCTTTTCTTGGAAGCGACA
   SARSCoV_1200_15_LEFT	TTTTAAGGAATTACTTGTGTATGCTGCT
   SARSCoV_1200_15_RIGHT	ACACACAACAGCATCGTCAGAG
   SARSCoV_1200_17_LEFT	TCAAGCTTTTTGCAGCAGAAACG
   SARSCoV_1200_17_RIGHT	CCAAGCAGGGTTACGTGTAAGG
   SARSCoV_1200_19_LEFT	GGCACATGGCTTTGAGTTGACA
   SARSCoV_1200_19_RIGHT	CCTGTTGTCCATCAAAGTGTCCC
   SARSCoV_1200_21_LEFT	TCTGTAGTTTCTAAGGTTGTCAAAGTGA
   SARSCoV_1200_21_RIGHT	GCAGGGGGTAATTGAGTTCTGG
   21_right_spike	GTGTATGATTGAGTTCTGGTTGTAAG
   SARSCoV_1200_23_LEFT	ACTTTAGAGTCCAACCAACAGAATCT
   23_left_spike	ACTTTAGAGTTCAACCAACAGAATCT
   SARSCoV_1200_23_RIGHT	TGACTAGCTACACTACGTGCCC
   SARSCoV_1200_25_LEFT	TGCTGCTACTAAAATGTCAGAGTGT
   SARSCoV_1200_25_RIGHT	CATTTCCAGCAAAGCCAAAGCC
   SARSCoV_1200_27_LEFT	TGGATCACCGGTGGAATTGCTA
   SARSCoV_1200_27_RIGHT	TGTTCGTTTAGGCGTGACAAGT
   SARSCoV_1200_29_LEFT	TGAGGGAGCCTTGAATACACCA
   SARSCoV_1200_29_RIGHT	TAGGCAGCTCTCCCTAGCATTG

   Pool B

   Primer name	Primer sequences
   SARSCoV_1200_2_LEFT	CCATAATCAAGACTATTCAACCAAGGGT
   SARSCoV_1200_2_RIGHT	ACAGGTGACAATTTGTCCACCG
   SARSCoV_1200_4_LEFT	GGAATTTGGTGCCACTTCTGCT
   SARSCoV_1200_4_RIGHT	CCTGACCCGGGTAAGTGGTTAT
   SARSCoV_1200_6_LEFT	ACTTCTATTAAATGGGCAGATAACAACTG
   SARSCoV_1200_6_RIGHT	GATTATCCATTCCCTGCGCGTC
   SARSCoV_1200_8_LEFT	CAATCATGCAATTGTTTTTCAGCTATTTTG
   SARSCoV_1200_8_RIGHT	TGACTTTTTGCTACCTGCGCAT
   SARSCoV_1200_10_LEFT	TTTACCAGGAGTTTTCTGTGGTGT
   SARSCoV_1200_10_RIGHT	TGGGCCTCATAGCACATTGGTA
   SARSCoV_1200_12_LEFT	ATGGTGCTAGGAGAGTGTGGAC
   SARSCoV_1200_12_RIGHT	GGATTTCCCACAATGCTGATGC
   SARSCoV_1200_14_LEFT	ACAGGCACTAGTACTGATGTCGT
   SARSCoV_1200_14_RIGHT	GTGCAGCTACTGAAAAGCACGT
   SARSCoV_1200_16_LEFT	ACAACACAGACTTTATGAGTGTCTCT
   SARSCoV_1200_16_RIGHT	CTCTGTCAGACAGCACTTCACG
   SARSCoV_1200_18_LEFT	GCACATAAAGACAAATCAGCTCAATGC
   SARSCoV_1200_18_RIGHT	TGTCTGAAGCAGTGGAAAAGCA
   SARSCoV_1200_20_LEFT	ACAATTTGATACTTATAACCTCTGGAACAC
   SARSCoV_1200_20_RIGHT	GATTAGGCATAGCAACACCCGG
   SARSCoV_1200_22_LEFT	GTGATGTTCTTGTTAACAACTAAACGAACA
   SARSCoV_1200_22_RIGHT	AACAGATGCAAATCTGGTGGCG
   22_right_spike	AACAGATGCAAATTTGGTGGCG
   SARSCoV_1200_24_LEFT	GCTGAACATGTCAACAACTCATATGA
   24_left_spike	GCTGAATATGTCAACAACTCATATGA
   SARSCoV_1200_24_RIGHT	ATGAGGTGCTGACTGAGGGAAG
   SARSCoV_1200_26_LEFT	GCCTTGAAGCCCCTTTTCTCTA
   SARSCoV_1200_26_RIGHT	AATGACCACATGGAACGCGTAC
   SARSCoV_1200_28_LEFT	TTTGTGCTTTTTAGCCTTTCTGCT
   SARSCoV_1200_28_RIGHT	GTTTGGCCTTGTTGTTGTTGGC
   SARSCoV_1200_28_LEFT_27837T	TTTGTGCTTTTTAGCCTTTCTGTT

6. Rapid barcode sequences

   Component	Sequence
   RB01	AAGAAAGTTGTCGGTGTCTTTGTG
   RB02	TCGATTCCGTTTGTAGTCGTCTGT
   RB03	GAGTCTTGTGTCCCAGTTACCAGG
   RB04	TTCGGATTCTATCGTGTTTCCCTA
   RB05	CTTGTCCAGGGTTTGTGTAACCTT
   RB06	TTCTCGCAAAGGCAGAAAGTAGTC
   RB07	GTGTTACCGTGGGAATGAATCCTT
   RB08	TTCAGGGAACAAACCAAGTTACGT
   RB09	AACTAGGCACAGCGAGTCTTGGTT
   RB10	AAGCGTTGAAACCTTTGTCCTCTC
   RB11	GTTTCATCTATCGGAGGGAATGGA
   RB12	CAGGTAGAAAGAAGCAGAATCGGA
   RB13	AGAACGACTTCCATACTCGTGTGA
   RB14	AACGAGTCTCTTGGGACCCATAGA
   RB15	AGGTCTACCTCGCTAACACCACTG
   RB16	CGTCAACTGACAGTGGTTCGTACT
   RB17	ACCCTCCAGGAAAGTACCTCTGAT
   RB18	CCAAACCCAACAACCTAGATAGGC
   RB19	GTTCCTCGTGCAGTGTCAAGAGAT
   RB20	TTGCGTCCTGTTACGAGAACTCAT
   RB21	GAGCCTCTCATTGTCCGTTCTCTA
   RB22	ACCACTGCCATGTATCAAAGTACG
   RB23	CTTACTACCCAGTGAACCTCCTCG
   RB24	GCATAGTTCTGCATGATGGGTTAG
   RB25	GTAAGTTGGGTATGCAACGCAATG
   RB26	CATACAGCGACTACGCATTCTCAT
   RB27	CGACGGTTAGATTCACCTCTTACA
   RB28	TGAAACCTAAGAAGGCACCGTATC
   RB29	CTAGACACCTTGGGTTGACAGACC
   RB30	TCAGTGAGGATCTACTTCGACCCA
   RB31	TGCGTACAGCAATCAGTTACATTG
   RB32	CCAGTAGAAGTCCGACAACGTCAT
   RB33	CAGACTTGGTACGGTTGGGTAACT
   RB34	GGACGAAGAACTCAAGTCAAAGGC
   RB35	CTACTTACGAAGCTGAGGGACTGC
   RB36	ATGTCCCAGTTAGAGGAGGAAACA
   RB37	GCTTGCGATTGATGCTTAGTATCA
   RB38	ACCACAGGAGGACGATACAGAGAA
   RB39	CCACAGTGTCAACTAGAGCCTCTC
   RB40	TAGTTTGGATGACCAAGGATAGCC
   RB41	GGAGTTCGTCCAGAGAAGTACACG
   RB42	CTACGTGTAAGGCATACCTGCCAG
   RB43	CTTTCGTTGTTGACTCGACGGTAG
   RB44	AGTAGAAAGGGTTCCTTCCCACTC
   RB45	GATCCAACAGAGATGCCTTCAGTG
   RB46	GCTGTGTTCCACTTCATTCTCCTG
   RB47	GTGCAACTTTCCCACAGGTAGTTC
   RB48	CATCTGGAACGTGGTACACCTGTA
   RB49	ACTGGTGCAGCTTTGAACATCTAG
   RB50	ATGGACTTTGGTAACTTCCTGCGT
   RB51	GTTGAATGAGCCTACTGGGTCCTC
   RB52	TGAGAGACAAGATTGTTCGTGGAC
   RB53	AGATTCAGACCGTCTCATGCAAAG
   RB54	CAAGAGCTTTGACTAAGGAGCATG
   RB55	TGGAAGATGAGACCCTGATCTACG
   RB56	TCACTACTCAACAGGTGGCATGAA
   RB57	GCTAGGTCAATCTCCTTCGGAAGT
   RB58	CAGGTTACTCCTCCGTGAGTCTGA
   RB59	TCAATCAAGAAGGGAAAGCAAGGT
   RB60	CATGTTCAACCAAGGCTTCTATGG
   RB61	AGAGGGTACTATGTGCCTCAGCAC
   RB62	CACCCACACTTACTTCAGGACGTA
   RB63	TTCTGAAGTTCCTGGGTCTTGAAC
   RB64	GACAGACACCGTTCATCGACTTTC
   RB65	TTCTCAGTCTTCCTCCAGACAAGG
   RB66	CCGATCCTTGTGGCTTCTAACTTC
   RB67	GTTTGTCATACTCGTGTGCTCACC
   RB68	GAATCTAAGCAAACACGAAGGTGG
   RB69	TACAGTCCGAGCCTCATGTGATCT
   RB70	ACCGAGATCCTACGAATGGAGTGT
   RB71	CCTGGGAGCATCAGGTAGTAACAG
   RB72	TAGCTGACTGTCTTCCATACCGAC
   RB73	AAGAAACAGGATGACAGAACCCTC
   RB74	TACAAGCATCCCAACACTTCCACT
   RB75	GACCATTGTGATGAACCCTGTTGT
   RB76	ATGCTTGTTACATCAACCCTGGAC
   RB77	CGACCTGTTTCTCAGGGATACAAC
   RB78	AACAACCGAACCTTTGAATCAGAA
   RB79	TCTCGGAGATAGTTCTCACTGCTG
   RB80	CGGATGAACATAGGATAGCGATTC
   RB81	CCTCATCTTGTGAAGTTGTTTCGG
   RB82	ACGGTATGTCGAGTTCCAGGACTA
   RB83	TGGCTTGATCTAGGTAAGGTCGAA
   RB84	GTAGTGGACCTAGAACCTGTGCCA
   RB85	AACGGAGGAGTTAGTTGGATGATC
   RB86	AGGTGATCCCAACAAGCGTAAGTA
   RB87	TACATGCTCCTGTTGTTAGGGAGG
   RB88	TCTTCTACTACCGATCCGAAGCAG
   RB89	ACAGCATCAATGTTTGGCTAGTTG
   RB90	GATGTAGAGGGTACGGTTTGAGGC
   RB91	GGCTCCATAGGAACTCACGCTACT
   RB92	TTGTGAGTGGAAAGATACAGGACC
   RB93	AGTTTCCATCACTTCAGACTTGGG
   RB94	GATTGTCCTCAAACTGCCACCTAC
   RB95	CCTGTCTGGAAGAAGAATGGACTT
   RB96	CTGAACGGTCATAGAGTCCACCAT

1. MinION Mk1B IT requirements

   Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION Mk1B IT Requirements document.

2. MinION Mk1C IT requirements

   The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. Read more in the MinION Mk1C IT requirements document.

3. Software for nanopore sequencing

   MinKNOW

   The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

   For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

   EPI2ME (optional)

   The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

   For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

4. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

1. Important Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation, which may affect sensitivity.
2. In a clean pre-PCR hood, place a fresh 96-well plate (RT plate) into a PCR Cooler (if using). Using a stepper pipette, or multichannel pipette, add 2 µl of LunaScript RT SuperMix (LS RT) per well.

   Depending on the number of samples, fill each well per column as follows:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	1-3	1-6	1-12

   

3. To each well containing LunaScript RT SuperMix (LS RT), add 8 µl of sample and gently mix by pipetting. If adding less than 8 µl, make up the rest of the volume with nuclease-free water.

   Example for X48 samples:
   

4. Important We recommend having a negative control and a positive control for every plate of samples.
5. Seal the RT plate and spin down.
6. Incubate the samples in the thermal cycler using the following program:

   Step	Temperature	Time	Cycles
   Primer annealing	25°C	2 min	1
   cDNA synthesis	55°C	10 min	1
   Heat inactivation	95°C	1 min	1
   Hold	4°C	∞

7. End of Step While the reverse transcription reaction is running, prepare the master mixes as described in the next section.

1. Primer design

   To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA, primers were designed by Freed et al., 2020 using Primal Scheme. These primers are designed to generate 1200 bp amplicons that overlap by approximately 20 bp. These primer sequences can be found here.

2. Important We recommend handling the primers in a clean template-free PCR hood.
3. In the template-free pre-PCR hood, prepare the following master mixes in Eppendorf DNA LoBind tubes and mix thoroughly as follows:

   Volume per sample:

   Reagent	Pool A	Pool B
   Nuclease-free water	3.7 µl	3.7 µl
   Midnight Primer Pool A (MP A)	0.05 µl	-
   Midnight Primer Pool B (MP B)	-	0.05 µl
   Q5 HS Master Mix (Q5)	6.25 µl	6.25 µl
   Total	10 µl	10 µl

   For x24 samples:

   Reagent	Pool A	Pool B
   Nuclease-free water	102 µl	102 µl
   Midnight Primer Pool A (MP A)	2 µl	-
   Midnight Primer Pool B (MP B)	-	2 µl
   Q5 HS Master Mix (Q5)	172 µl	172 µl
   Total	276 µl	276 µl

   For x48 samples:

   Reagent	Pool A	Pool B
   Nuclease-free water	203 µl	203 µl
   Midnight Primer Pool A (MP A)	3 µl	-
   Midnight Primer Pool B (MP B)	-	3 µl
   Q5 HS Master Mix (Q5)	344 µl	344 µl
   Total	550 µl	550 µl

   For x96 samples:

   Reagent	Pool A	Pool B
   Nuclease-free water	407 µl	407 µl
   Midnight Primer Pool A (MP A)	6 µl	-
   Midnight Primer Pool B (MP B)	-	6 µl
   Q5 HS Master Mix (Q5)	687 µl	687 µl
   Total	1,100 µl	1,100 µl

4. Using a stepper pipette or a multichannel pipette, aliquot 10 µl of Pool A and Pool B into a clean 96-well plate(s) as follows:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	Pool A: 1-3 Pool B: 4-6	Pool A: 1-6 Pool B: 7-12	Pool A: 1-12 Pool B: 1-12

   Note: For X96 samples, Pool A is a separate plate to Pool B.

   

5. Using a multichannel pipette, transfer 2.5 μl of each RT reaction from the RT plate to the corresponding well for both Pool A and Pool B in the PCR plate(s), taking care not to cross-contaminate different wells. Mix by pipetting the contents of each well up and down.

   There should be two PCR reactions per sample.

   Example for X48 samples:
   

6. Mix by pipetting the contents of each well up and down.
7. Important Carry forward the negative control from the reverse transcription reaction to monitor cross-contamination events.

   We recommend having a negative control and a positive control for every plate of samples.

8. Seal the plate(s) and spin down briefly.
9. Incubate using the following program, with the heated lid set to 105°C:

   Step	Temperature	Time	Cycles
   Initial denaturation	98°C	30 sec	1
   Denaturation Annealing and extension	98°C 61°C 65°C	15 sec 2 min 3 min	35
   Hold	4°C	∞

10. Optional Action

    If necessary, the protocol can be paused at this point. The samples should be kept at 4°C and can be stored overnight.

1. Spin down the Rapid Barcode Plate and PCR reactions prior to opening to collect material in the bottom of the wells.
2. Using a multichannel pipette or stepper pipette, transfer 2.5 μl nuclease-free water to the wells of a fresh 96-well plate (Barcode Attachment Plate).

   Depending on the number of samples, aliquot into each well of the columns as follows:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	1-3	1-6	1-12

   

3. Using a multichannel pipette, transfer the entire contents of each well of PCR Pool B to the corresponding well of PCR Pool A and mix by pipetting.

   Depending on the number of samples, Pool B columns will correspond to different Pool A columns.

   No. of samples	Pool B column	Corresponding Pool A column
   X24	4 5 6	1 2 3
   X48	7 8 9 10 11 12	1 2 3 4 5 6
   X96	1 2 3 4 5 6 7 8 9 10 11 12	1 2 3 4 5 6 7 8 9 10 11 12

   Example for X48 samples:
   

4. Using a multichannel pipette, transfer 5 µl from each well of PCR Pool A (now containing pooled PCR products) to the corresponding well of the Barcode Attachment Plate and mix by pipetting.

   Depending on the number of samples, PCR Pool A will be in each well of the following columns:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	1-3	1-6	1-12

   Example for X48 samples:
   

5. Using a multichannel pipette, transfer 2.5 μl from the Rapid Barcode Plate to the corresponding well of the Barcode Attachment Plate, taking care not to cross-contaminate different wells. Mix by pipetting.

   Depending on the number of samples, aliquot into each well of the columns as follows:

   Plate location	X24 samples	X48 samples	X96 samples
   Columns	1-3	1-6	1-12

   Example for X48 samples:
   

6. Important Samples must be thoroughly mixed.
7. Seal the Barcode Attachment Plate and spin down.
8. Incubate the plate in a thermal cycler at 30°C for 2 minutes and then at 80°C for 2 minutes.

1. Briefly spin down the Barcode Attachment Plate to collect the liquid at the bottom of the wells prior to opening.
2. Pool the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.

   We expect to have about ~10 µl per sample.

   	X24 samples	X48 samples	X96 samples
   Total volume	~240 µl	~480 µl	~960 µl

3. Mix pooled samples by vortexing.
4. Important Pooled barcoded samples must be thoroughly mixed.
5. Transfer half of the barcoded pooled sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

   Per sample, we expect to take forward ~5 µl.

   	X24 samples	X48 samples	X96 samples
   Example volume	120 µl	240 µl	480 µl

6. Resuspend the AMPure XP Beads (AXP) by vortexing.
7. To the pooled barcoded sample, add an equal volume of resuspended AMPure XP Beads (AXP, or SPRI) and mix by pipetting.

   Example volume	X24 samples	X48 samples	X96 samples
   Volume of 1X AXP	120 µl	240 µl	480 µl

8. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
9. Prepare at least 3 ml of fresh 80% ethanol in nuclease-free water.
10. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
11. Keep the tube on the magnet and wash the beads with 1 ml of freshly-prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
12. Repeat the previous step.
13. Briefly spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.
14. Remove the tube from the magnetic rack and resuspend the pellet by pipetting in 15 µl Elution Buffer (EB). Incubate for 10 minutes at room temperature.
15. Pellet the beads on a magnet until the eluate is clear and colourless.
16. Remove and retain 15 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.
17. Quantify DNA concentration by using the Qubit dsDNA HS Assay Kit.
18. Take forward 11 µl of your eluted DNA library.
19. In a fresh 1.5 ml Eppendorf DNA LoBind tube, dilute the Rapid Adapter (RA) as follows and pipette mix:

    Reagent	Volume
    Rapid Adapter (RA)	1.5 μl
    Adapter Buffer (ADB)	3.5 μl
    Total	5 μl

20. Add 1 µl of the diluted Rapid Adapter (RA) to the barcoded DNA.
21. Mix gently by flicking the tubes, and spin down.
22. Incubate the reaction for 5 minutes at room temperature.
23. End of Step The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.

1. Important Please note, this kit is only compatible with R10.4.1 flow cells (FLO-MIN114).
2. Tip Priming and loading a flow cell

   We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

3. Using the Library Solution

   For most sequencing experiments, use the Library Beads (LIB) for loading your library onto the flow cell. However, for viscous libraries it may be difficult to load with the beads and may be appropriate to load using the Library Solution (LIS).

4. Thaw the Sequencing Buffer (SB), Library Beads (LIB) or Library Solution (LIS, if using), Flow Cell Tether (FCT) and Flow Cell Flush (FCF) at room temperature before mixing by vortexing. Then spin down and store on ice.
5. Important For optimal sequencing performance and improved output on MinION R10.4.1 flow cells (FLO-MIN114), we recommend adding Bovine Serum Albumin (BSA) to the flow cell priming mix at a final concentration of 0.2 mg/ml.

   Note: We do not recommend using any other albumin type (e.g. recombinant human serum albumin).

6. Prepare the flow cell priming mix with BSA in a suitable tube for the number of flow cells to flush. Once combined, mix well by pipette mixing.

   Reagents	Volume per flow cell
   Flow Cell Flush (FCF)	1,170 µl
   Bovine Serum Albumin (BSA) at 50 mg/ml	5 µl
   Flow Cell Tether (FCT)	30 µl
   Total volume	1,205 µl

7. Open the MinION or GridION device lid and slide the flow cell under the clip. Press down firmly on the flow cell to ensure correct thermal and electrical contact.

   

   

8. Optional Action

   Complete a flow cell check to assess the number of pores available before loading the library.

   This step can be omitted if the flow cell has been checked previously.

   See the flow cell check instructions in the MinKNOW protocol for more information.

9. Slide the flow cell priming port cover clockwise to open the priming port.

   

10. Important Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
11. After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
    1. Set a P1000 pipette to 200 µl
    2. Insert the tip into the priming port
    3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
       

    Note: Visually check that there is continuous buffer from the priming port across the sensor array.

    

12. Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

    

13. Thoroughly mix the contents of the Library Beads (LIB) by pipetting.
14. Important The Library Beads (LIB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

    We recommend using the Library Beads (LIB) for most sequencing experiments. However, the Library Solution (LIS) is available for more viscous libraries.

15. In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:

    Reagent	Volume per flow cell
    Sequencing Buffer (SB)	37.5 µl
    Library Beads (LIB) mixed immediately before use, or Library Solution (LIS), if using	25.5 µl
    DNA library	12 µl
    Total	75 µl

16. Complete the flow cell priming:
    1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
    2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

    

    

17. Mix the prepared library gently by pipetting up and down just prior to loading.
18. Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

    

19. Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

    

    

20. Important Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

    We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

21. Place the light shield onto the flow cell, as follows:

    1. Carefully place the leading edge of the light shield against the clip.
       Note: Do not force the light shield underneath the clip.

    2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

    

22. Caution The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
23. End of Step Close the device lid and set up a sequencing run on MinKNOW.

1. Overview of nanopore data analysis

   For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

2. Important Required settings in MinKNOW

   The correct barcoding parameters must be set up on MinKNOW prior to the sequencing run. During the run setup, in the Analysis tab:

   1. Enable Barcoding.
   2. Select Edit options.
   3. Enable Mid-read barcode filtering.
   4. Enable Override minimum barcoding score and set the value to 60.
   5. Enable Override minimum mid-read barcoding score and set the value to 50.

   

   

3. How to start sequencing

   The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:

   1. Data acquisition and basecalling in real-time using MinKNOW on a computer

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.

   2. Data acquisition and basecalling in real-time using the GridION device

   Follow the instructions in the GridION user manual.

   3. Data acquisition and basecalling in real-time using the MinION Mk1C device

   Follow the instructions in the MinION Mk1C user manual.

   4. Data acquisition and basecalling in real-time using the PromethION device

   Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.

   5. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.

1. Recommended pipeline analysis

   The wf-artic is a bioinformatics workflow for the analysis of ARTIC sequencing data prepared using the Midnight protocol. The bioinformatics workflow is orchestrated by the Nextflow software. Nextflow is a publicly available and open-source project that enables the execution of scientific workflows in a scalable and reproducible way. The use of the Nextflow software has been integrated into the EPI2ME Labs software that we recommend for running our downstream analysis methods.

   Alternative methods for downstream analysis are available using your device terminal or command line, however we only suggest this for experienced users.

   Demultiplexed sequence reads are processed using the ARTIC Field Bioinformatics software that has been modified for the analysis of FASTQ sequences prepared using Oxford Nanopore Rapid Sequencing kits. The other modification to the ARTIC workflow is the use of a primer scheme that defines the sequencing primers used by the Midnight protocol and their genomic locations on the SARS-CoV-2 genome.

   The wf-artic workflow includes other analytical steps that include cladistic analysis using Nextclade and strain assignment using Pangolin. The data facets included in the report are parameterised and additional information such as plots of depth-of-coverage across the reference genome is optional.

   The complete source for wf-artic is linked, and the Nextflow software will download the scripts and logic flow from this location.

   The wf-artic workflow needs to be started manually as outlined below in 'Running a Midnight analysis using EPI2ME Labs'.

2. Software set-up and installation

   The EPI2ME application provides a clean interface to accessing bioinformatics workflows, and is our recommended method in performing your post-sequencing analysis.

   Follow the instructions in the EPI2ME Installation guide to install the application on your device.

   For more information on how to use EPI2ME, refer to the EPI2ME Quick Start guide.

3. Installing and updating the wf-artic workflow in EPI2ME Labs:

   Ensure you have installed the wf-artic workflow prior to the first analysis set-up.

   In the EPI2ME Labs home page, scroll down to the "Install workflows" section and click on epi2me-labs/wf-artic:

   

   If you have already installed the wf-artic workflow, ensure you are using the latest version.

   Updating the workflow can be done directly through EPI2ME Labs by navigating to the wf-artic workflow page and clicking Update Workflow:

   

4. Demultiplexing of multiple barcoded samples

   The wf-artic analysis requires FASTQ sequence data that has already been demultiplexed.

   Reads will be demultiplexed during sequencing if you are following the recommended "Required settings in MinKNOW". However, demultiplexing can also be done post-sequencing using the MinKNOW software.

   For more information and guides on demultiplexing using MinKNOW, refer to the "Post-run analysis" section in our MinKNOW Protocol.

   The expected input for wf-artic is a folder of folders as shown below. Each of the barcode folders should contain the FASTQ sequence data and files may either be uncompressed or gzipped.

   $ tree -d MidnightFastq/

   MidnightFastq/

   ├── barcode01

   ├── barcode02

   ├── barcode03

   ├── barcode04

   ├── barcode05

   ├── barcode06

   └── unclassified

5. Important Basecalling model

   The basecalling model should be specified when setting up the wf-artic analysis. This should reflect the basecalling model selected during your run set-up as follows:

   • If using the default model, High-accuracy basecalling (HAC): r1041_e82_400bps_hac_variant_g615
   • If you have used Super accurate basecalling (SUP), please use: r1041_e82_400bps_sup_variant_g615
   • If you have used FAST basecalling, please use: r1041_e82_400bps_fast_variant_g615
6. Running a Midnight analysis using EPI2ME Labs
7. Open the EPI2ME Labs application on your device.

   

8. Open the "Workflows" tab in the EPI2ME Labs application and click on the "wf-artic" workflow:

   

9. In the "wf-artic" workflow page, select "Run this workflow" to open analysis set-up:

   

10. Complete the wf-artic run set-up:

    Select your data input file location. Please note, this folder must contain the demultiplexed FASTQ files of your sequencing run.

    

    Expand the Primer Scheme Selection tab and set the Scheme version to Midnight-ONT/V3.

    

    Expand the Advanced Options tab and set the Medaka model to the basecalling model used in your sequencing run.

    

    

    Expand the Extra configuration tab and set the Run name for your wf-artic analysis.

    

    Click Launch workflow at the bottom of the page to begin your analysis.

11. Navigate to the "Analysis" tab in the EPI2ME Labs application to monitor your run:

    

12. Completed analysis and result files

    The wf-artic analysis outputs will be written to the Working Directory folder specified in the EPI2ME Labs Settings tab.
    The location of this folder is specified in the wf-artic run Instance parameters preceeded by out_dir.

    However, these files can also be accessed directly in the EPI2ME Labs application from the completed analysis page for your run:

    

    These outputs include:

    • all_consensus.fasta
      A multi-FASTA format sequence file containing the consensus sequence for each of the samples investigated. This consensus sequence has been prepared for the whole SARS-CoV-2 genome, not just the spike protein region. The consensus sequence masks the non-spike regions and regions of low sequence coverage with N residues.

    • all_variants.vcf.gz
      A gzipped VCF file that describes all high-quality genetic variants called by medaka from the sequenced samples.

    • all_variants.vcf.gz.tbi
      An index file for the gzipped VCF file.

    • consensus_status.txt
      A tab delimited file that reports whether a consensus sequence has been successfully prepared for a sample, or not.

    • wf-artic-report.html
      A report summarising these data. This HTML format report also includes the output of the Nextclade software that can be used for a visual inspection of, for example, primer drop out or other qualitative consensus sequence aspects.

    Other files are included in the work-directory. This includes per sample VCF files of all genetic variants prior to filtering and other sequences.

13. Housekeeping and disk usage

    The "Working Directory" can be specified in the EPI2ME Labs "Settings" tab and defines where the workflow intermediate files and outputs are stored.

    This folder will accumulate a significant number of files that correspond to raw BAM files, other larger intermediates and analysis results files. We recommend this folder to be routinely cleared.

1. After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at 2-8°C.

   The Flow Cell Wash Kit protocol is available on the Nanopore Community.

2. Tip We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
3. Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.

   Instructions for returning flow cells can be found here.

   Note: All flow cells must be flushed with deionised water before returning the product.

4. Important If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation).	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.

11. Guppy – no input .fast5 was found or basecalled

    Observation	Possible cause	Comments and actions
    No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
    No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

12. Guppy – no Pass or Fail folders were generated after basecalling

    Observation	Possible cause	Comments and actions
    No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

13. Guppy – unusually slow processing on a GPU computer

    Observation	Possible cause	Comments and actions
    Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.