Ligation sequencing V14 - Direct cDNA sequencing (SQK-LSK114)

Version for device: MinION

1. Direct cDNA Sequencing V14 with SQK-LSK114 features

   This protocol is recommended for users who:

   • Are interested in exploring novel RNA biology.
   • Are looking for splice variant and fusion transcript analysis.
   • Do not wish to use PCR.
   • Wish to preserve quantitative information in samples likely to be impacted by PCR bias.
   • Would like full-length cDNA strands.
   • Want to achieve median raw read accuracy of Q20+ (99%) and above.
   • Want to optimise their sequencing experiment for output.
2. Introduction to the Direct cDNA sequencing protocol

   This protocol describes how to carry out sequencing of cDNA using a reverse transcription and stand-switching method and the Ligation Sequencing Kit V14 (SQK-LSK114).

   This protocol requires the use of three oligo primers to be ordered from a third-party (e.g. IDT):

   Oligo	Sequence (5' to 3')
   VN Primer	/5phos/ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN
   Strand-switching Primer	TTTCTGTTGGTGCTGATATTGCTmGmGmG
   PR2 Primer	/5Phos/TTTCTGTTGGTGCTGATATTGC

   Note: mG = 2' O-Methyl RNA bases.

   • The VN Primer will anchor to the RNA Poly(A)+ tail and prime the first strand synthesis.
   • The Strand-switching Primer will anneal to the non-template nucleotides (C’s) of the novel cDNA strand generated from the first strand synthesis, enabling strand switching.
   • Following RNA degradation, the PR2 Primer will prime the second strand synthesis of the cDNA sample.

   Using this strand-switching method allows for high yields of cDNA library generation from RNA, while also selecting for full-length transcripts.

   Steps in the sequencing workflow:

   Prepare for your experiment

   You will need to:

   • Order the three oligo primers from a third-party
   • Extract your RNA, and check its length, quantity and purity. Alternatively, you can start with already-prepared cDNA. The quality checks performed during the protocol are essential in ensuring experimental success
   • Ensure you have your sequencing kit, the correct equipment and third-party reagents
   • Download the software for acquiring and analysing your data Check your flow cell to ensure it has enough pores for a good sequencing run

   
   

   Library preparation

   You will need to:

   • Using the strand-switching protocol, prepare full-length cDNAs from Poly(A)+ RNA
   • Ligate sequencing adapters to the cDNA
   • Prime the flow cell, and load your cDNA library into the flow cell

   

   Sequencing and analysis

   You will need to:
   - Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
   - (Optional): Start the EPI2ME software and select a workflow for further analysis, e.g. Fastq yeast transcriptome analysis

3. Caution Data ananlysis for the Ligation sequencing V14 - Direct cDNA sequencing (SQK-LSK114) is currently incompatible with the default setup for wf-transcriptomes.

   Data ananlysis for the Ligation sequencing V14 - Direct cDNA sequencing (SQK-LSK114) is currently incompatible with the default setup for wf-transcriptomes.
   Pychopper currently miss-classsifies The reads generated with Direct cDNA Sequencing are not being classified correctly in the analysis workflow, leading to ≥80% data loss of full-read transcripts following analysis with wf-transcriptomes.

   Note: Experienced users may be able to disable Pychopper during wf-transcriptomes analysis setup to circumvent this issue using the infomation available in the wf-transcriptomes GitHub page and the Pychopper GitHub page.
   Please note that deviating from the standard analysis settings can result in changes to the analysis output.

4. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • Ligation Sequencing Kit V14 (SQK-LSK114)
   • R10.4.1 flow cells (FLO-MIN114)
   • Flow Cell Wash Kit (EXP-WSH004)

1. For this protocol, you will need 100 ng Poly(A)+ RNA or 1 µg of total RNA.

   If using alternative cDNA preparation methods, start the protocol with 70–200 fmol of pre-prepared cDNA at the cDNA repair and end-prep step.

2. This protocol requires primer oligos to be ordered separately:

   Oligo	Sequence (5' to 3')	Purity recommended	Dilution required
   VN Primer	/5phos/ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN	HPLC	2 µM
   Strand-switching Primer	TTTCTGTTGGTGCTGATATTGCTmGmGmG	HPLC	10 µM
   PR2 Primer	/5Phos/TTTCTGTTGGTGCTGATATTGC	HPLC	10 µM

   Note: mG = 2' O-Methyl RNA bases.

   Note: Please ensure your primer oligos are ordered at HPLC purity level for optimal results.
   If ordering from IDT, the primer oligos will need to be ordered at a minimum scale of 100 nmole to enable HPLC purification.

3. Input RNA

   It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.

   For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.

   For further information on using RNA as input, please read the links below.

   • Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
   • RNA contaminants
   • RNA stability
   • RNA Integrity Number (RIN)
   • Enrichment of polyadenylated RNA molecules

   These documents can also be found in the DNA/RNA Handling page.

4. NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing

   For customers new to nanopore sequencing, we recommend buying the NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing (catalogue number E7180S or E7180L), which contains all the NEB reagents needed for use with the Ligation Sequencing Kit.

   Please note, for this protocol, NEBNext FFPE DNA Repair Mix and NEBNext FFPE DNA Repair Buffer are not required.

5. Third-party reagents

   We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

   For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

6. Important We strongly recommend using the Ligation Buffer (LNB) supplied in the Ligation Sequencing Kit V14 rather than any third-party ligase buffers to ensure high ligation efficiency of the Ligation Adapter (LA).
7. Ligation Sequencing Kit V14 (SQK-LSK114) contents

   Note: We are in the process of reformatting our kits with single-use tubes into a bottle format.

   Single-use tubes format:
   

   Bottle format:
   

   Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

   Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.

1. MinION Mk1C IT requirements

   The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. Read more in the MinION Mk1C IT requirements document.

2. MinION Mk1B IT requirements

   Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION Mk1B IT Requirements document.

3. Software for nanopore sequencing

   MinKNOW

   The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

   For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

   EPI2ME (optional)

   The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

   For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

4. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

1. Important If you have already prepared your cDNA, use 70–200 fmol cDNA (~70–200 ng if your sample is 1.5 kb) and start from the cDNA repair and end-prep step.
2. Thaw the following reagents and spin down briefly using a microfuge, before mixing as indicated in the table below, and place on ice.

   Reagent	1. Thaw at room temperature	2. Briefly spin down	3. Mix well by pipetting
   User-supplied VN Primer diluted to 2 µM	✓	✓	✓
   User-supplied Strand-Switching Primer diluted to 10 µM	✓	✓	✓
   10 mM dNTP solution	✓	✓	✓
   RNaseOUT	Not frozen	✓	✓
   Maxima H Minus Reverse Transcriptase	Not frozen	✓	✓
   Maxima H Minus 5x RT Buffer	✓	✓	Mix by vortexing

3. Prepare the RNA in nuclease-free water
   • Transfer 100 ng Poly(A)+ RNA or 1 μg of total RNA into a 0.2 ml PCR tube
   • Adjust the volume to up to 7.5 μl with nuclease-free water
   • Mix by flicking the tube to avoid unwanted shearing
   • Spin down briefly in a microfuge

4. Prepare the following reaction in the 0.2 ml PCR tube containing the prepared RNA input:

   Reagent	Volume
   RNA input (100 ng Poly(A)+ RNA or 1 μg of total RNA) from step above	7.5 μl
   VN Primer diluted to 2 μM	2.5 μl
   10 mM dNTPs	1 μl
   Total volume	11 μl

5. Mix gently by flicking the tube, and spin down.
6. Incubate at 65°C for 5 minutes and then snap cool on a pre-chilled freezer block for 1 minute.
7. In a separate tube, mix together the following:

   Reagent	Volume
   5x RT Buffer	4 μl
   RNaseOUT	1 μl
   Nuclease-free water	1 μl
   Strand-Switching Primer diluted to 10 µM	2 μl
   Total	8 μl

8. Mix gently by flicking the tube, and spin down.
9. Add the 8 μl of strand-switching reagents (prepared in steps 6-7) to the 11 μl of snap-cooled mRNA (from steps 2-5). Mix by flicking the tube and spin down.
10. Incubate at 42°C for 2 minutes in the thermal cycler.
11. Add 1 µl of Maxima H Minus Reverse Transcriptase. The total volume is now 20 µl.
12. Mix gently by flicking the tube, and spin down.
13. Incubate using the following protocol using a thermal cycler:

    Cycle step	Temperature	Time	No. of cycles
    Reverse transcription and strand-switching	42°C	90 mins	1
    Heat inactivation	85°C	5 mins	1
    Hold	4°C	∞

1. Thaw the following reagents and spin down briefly using a microfuge, before mixing as indicated in the table below, and place on ice.

   Reagent	1. Thaw at room temperature	2. Briefly spin down	3. Mix well by pipetting
   User-supplied PR2 Primer diluted to 10 µM	✓	✓	✓
   RNase Cocktail Enzyme Mix	Not frozen	✓	✓
   LongAmp Taq 2X Master Mix	✓	✓	✓

2. Thaw the AMPure XP Beads (AXP) at room temperature and mix by vortexing. Keep the beads at room temperature.
3. Add 1 µl RNase Cocktail Enzyme Mix (ThermoFisher, cat # AM2286) to the reverse transcription reaction.
4. Incubate the reaction for 10 minutes at 37° C in a thermal cycler.
5. Resuspend the AMPure XP beads (AXP) by vortexing.
6. Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
7. Add 17 µl of resuspended AMPure XP beads (AXP) to the reaction and mix by flicking the tube.
8. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
9. Prepare 500 μl of fresh 80% ethanol in nuclease-free water.
10. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.
11. Keep the tubes on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

    If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.

12. Repeat the previous step.
13. Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
14. Remove the tube from the magnetic rack and resuspend pellet in 20 µl nuclease-free water.
15. Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.
16. Briefly spin down the tube and pellet the beads on the magnet until the eluate is clear and colourless, for at least 1 minute.
17. Remove and retain 20 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
18. Prepare the following reaction in a 0.2 ml thin-walled PCR tube:

    Reagent	Volume
    2x LongAmp Taq Master Mix	25 μl
    PR2 Primer diluted to 10 μM	2 μl
    Reverse-transcribed sample from above	20 μl
    Nuclease-free water	3 μl
    Total	50 μl

19. Incubate using the following protocol:

    Cycle step	Temperature	Time	No. of cycles
    Denaturation	94 °C	1 mins	1
    Annealing	50 °C	1 mins	1
    Extension	65 °C	15 mins	1
    Hold	4 °C	∞

20. Resuspend the AMPure XP beads (AXP) by vortexing.
21. Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
22. Add 40 µl of resuspended AMPure XP beads (AXP) to the reaction and mix by flicking the tube.
23. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
24. Prepare 500 μl of fresh 80% ethanol in nuclease-free water.
25. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.
26. Keep the tubes on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

    If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.

27. Repeat the previous step.
28. Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
29. Remove the tube from the magnetic rack and resuspend pellet in 21 µl nuclease-free water.
30. Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.
31. Briefly spin down the tube and pellet the beads on the magnet until the eluate is clear and colourless, for at least 1 minute.
32. Remove and retain 21 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
33. Analyse 1 µl of the strand-switched DNA for size, quantity and quality using an Agilent Bioanalyzer and Qubit fluorometer (or equivalent).
34. End of Step Take forward the full volume of your sample into the cDNA repair and end-prep stage of the protocol.

    Recovery aim for the samples after RNA degradation and second strand synthesis is 70–200 fmol (~70–200 ng if your sample is 1.5 kb).

1. Important If you have prepared your own cDNA instead of performing reverse transcription using the method outlined in this protocol, start this step with 70–200 fmol cDNA (~70–200 ng if your sample is 1.5 kb) in 20 µl nuclease-free water.
2. Prepare the NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer's instructions, and place on ice:

   For optimal performance, NEB recommend the following:

   1. Thaw all reagents on ice.

   2. Ensure the reagents are well mixed.
      
      Note: Do not vortex the Ultra II End Prep Enzyme Mix.

   3. Always spin down tubes before opening for the first time each day.

   4. The NEBNext Ultra II End Prep Reaction Buffer may contain a white precipitate. If this occurs, allow the mixture(s) to come to room temperature and pipette the buffer several times to break up the precipitate, followed by a quick vortex to mix.

3. Combine the following reagents in a 0.2 ml PCR tube:

   Reagent	Volume
   cDNA sample	20 µl
   Nuclease-free water	30 µl
   Ultra II End-prep reaction buffer	7 µl
   Ultra II End-prep enzyme mix	3 µl
   Total	60 µl

4. Thoroughly mix the reaction by gently pipetting and briefly spinning down.
5. Using a thermal cycler, incubate at 20°C for 5 minutes and 65°C for 5 minutes.
6. Resuspend the AMPure XP Beads (AXP) by vortexing.
7. Transfer the DNA sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
8. Add 60 µl of resuspended the AMPure XP Beads (AXP) to the end-prep reaction and mix by flicking the tube.
9. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
10. Prepare 500 μl of fresh 80% ethanol in nuclease-free water.
11. Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.
12. Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
13. Repeat the previous step.
14. Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
15. Remove the tube from the magnetic rack and resuspend pellet in 61 µl nuclease-free water. Incubate for 2 minutes at room temperature.
16. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
17. Remove and retain 61 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
18. Quantify 1 µl of eluted sample using a Qubit fluorometer.
19. End of Step Take forward the 60 µl of repaired and end-prepped cDNA into the adapter ligation step. However, at this point it is also possible to store the sample at 4°C overnight.

1. Important Although third-party ligase products may be supplied with their own buffer, the ligation efficiency of the Ligation Adapter (LA) is higher when using the Ligation Buffer (LNB) supplied in the Ligation Sequencing Kit.
2. Important Ligation Adapter (LA) included in this kit and protocol is not interchangeable with other sequencing adapters.
3. Spin down the Ligation Adapter (LA) and Quick T4 Ligase, and place on ice.
4. Thaw Ligation Buffer (LNB) at room temperature, spin down and mix by pipetting. Due to viscosity, vortexing this buffer is ineffective. Place on ice immediately after thawing and mixing.
5. Thaw the Elution Buffer (EB) at room temperature and mix by vortexing. Then spin down and place on ice.
6. Thaw the Short Fragment Buffer (SFB) at room temperature and mix by vortexing. Then spin down and place on ice.
7. In a 1.5 ml Eppendorf DNA LoBind tube, mix in the following order:

   Between each addition, pipette mix 10-20 times.

   Reagent	Volume
   cDNA sample from the previous step	60 µl
   Ligation Adapter (LA)	5 µl
   Ligation Buffer (LNB)	25 µl
   NEBNext Quick T4 DNA Ligase	10 µl
   Total	100 µl

8. Thoroughly mix the reaction by gently pipetting and briefly spinning down.
9. Incubate the reaction for 10 minutes at room temperature.
10. Resuspend the AMPure XP Beads (AXP) by vortexing.
11. Add 40 µl of resuspended AMPure XP Beads (AXP) to the reaction and mix by flicking the tube.
12. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
13. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
14. Wash the beads by adding 250 μl of Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.

    Note: Take care when removing the supernatant, the viscosity of the buffer can contribute to loss of beads from the pellet.

15. Repeat the previous step.
16. Spin down and place the tube back on the magnet. Pipette off any residual supernatant. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
17. Remove the tube from the magnetic rack and resuspend the pellet in 15 µl Elution Buffer (EB). Spin down and incubate for 10 minutes at room temperature.
18. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
19. Remove and retain 15 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

    Dispose of the pelleted beads

20. Quantify 1 µl of eluted sample using a Qubit fluorometer.
21. Depending on your DNA library fragment size, prepare your final library in 12 µl of Elution Buffer (EB).

    Fragment library length	Flow cell loading amount
    Very short (<1 kb)	100 fmol
    Short (1-10 kb)	35–50 fmol
    Long (>10 kb)	300 ng

    Note: If the library yields are below the input recommendations, load the entire library.

    If required, we recommend using a mass to mol calculator such as the NEB calculator.

22. Important We recommend loading 35-50 fmol of this final prepared library onto the R10.4.1 flow cell.

    This is to ensure high pore occupancy of >95% is reached. How to calculate pore occupancy can be found here.

23. End of Step The prepared library is used for loading into the flow cell. Store the library on ice or at 4°C until ready to load.
24. Tip Library storage recommendations

    We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short-term storage or repeated use, for example, re-loading flow cells between washes.
    For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

25. Optional Action

    If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

    Depending on how many flow cells the library will be split across, more Elution Buffer (EB) than what is supplied in the kit will be required.

1. Important Please note, this kit is only compatible with R10.4.1 flow cells (FLO-MIN114).
2. Tip Priming and loading a flow cell

   We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

3. Thaw the Sequencing Buffer (SB), Library Beads (LIB) or Library Solution (LIS, if using), Flow Cell Tether (FCT) and Flow Cell Flush (FCF) at room temperature before mixing by vortexing. Then spin down and store on ice.
4. Important For optimal sequencing performance and improved output on MinION R10.4.1 flow cells (FLO-MIN114), we recommend adding Bovine Serum Albumin (BSA) to the flow cell priming mix at a final concentration of 0.2 mg/ml.

   Note: We do not recommend using any other albumin type (e.g. recombinant human serum albumin).

5. To prepare the flow cell priming mix with BSA, combine Flow Cell Flush (FCF) and Flow Cell Tether (FCT), as directed below. Mix by pipetting at room temperature.

   Note: We are in the process of reformatting our kits with single-use tubes into a bottle format. Please follow the instructions for your kit format.

   Single-use tubes format:
   Add 5 µl Bovine Serum Albumin (BSA) at 50 mg/ml and 30 µl Flow Cell Tether (FCT) directly to a tube of Flow Cell Flush (FCF).

   Bottle format:
   In a suitable tube for the number of flow cells, combine the following reagents:

   Reagent	Volume per flow cell
   Flow Cell Flush (FCF)	1,170 µl
   Bovine Serum Albumin (BSA) at 50 mg/ml	5 µl
   Flow Cell Tether (FCT)	30 µl
   Total volume	1,205 µl

6. Open the MinION or GridION device lid and slide the flow cell under the clip. Press down firmly on the flow cell to ensure correct thermal and electrical contact.

   

   

7. Optional Action

   Complete a flow cell check to assess the number of pores available before loading the library.

   This step can be omitted if the flow cell has been checked previously.

   See the flow cell check instructions in the MinKNOW protocol for more information.

8. Slide the flow cell priming port cover clockwise to open the priming port.

   

9. Important Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
10. After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
    1. Set a P1000 pipette to 200 µl
    2. Insert the tip into the priming port
    3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
       

    Note: Visually check that there is continuous buffer from the priming port across the sensor array.

    

11. Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

    

12. Thoroughly mix the contents of the Library Beads (LIB) by pipetting.
13. Important The Library Beads (LIB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

    We recommend using the Library Beads (LIB) for most sequencing experiments. However, the Library Solution (LIS) is available for more viscous libraries.

14. In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:

    Reagent	Volume per flow cell
    Sequencing Buffer (SB)	37.5 µl
    Library Beads (LIB) mixed immediately before use, or Library Solution (LIS), if using	25.5 µl
    DNA library	12 µl
    Total	75 µl

15. Complete the flow cell priming:
    1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
    2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

    

    

16. Mix the prepared library gently by pipetting up and down just prior to loading.
17. Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

    

18. Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

    

    

19. Important Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

    We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

20. Place the light shield onto the flow cell, as follows:

    1. Carefully place the leading edge of the light shield against the clip.
       Note: Do not force the light shield underneath the clip.

    2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

    

21. Caution The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
22. End of Step Close the device lid and set up a sequencing run on MinKNOW.

1. Overview of nanopore data analysis

   For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

2. How to start sequencing

   The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:

   1. Data acquisition and basecalling in real-time using MinKNOW on a computer

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.

   2. Data acquisition and basecalling in real-time using the GridION device

   Follow the instructions in the GridION user manual.

   3. Data acquisition and basecalling in real-time using the MinION Mk1C device

   Follow the instructions in the MinION Mk1C user manual.

   4. Data acquisition and basecalling in real-time using the PromethION device

   Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.

   5. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW

   Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.

1. Caution Data ananlysis for the Ligation sequencing V14 - Direct cDNA sequencing (SQK-LSK114) is currently incompatible with the default setup for wf-transcriptomes.

   Data ananlysis for the Ligation sequencing V14 - Direct cDNA sequencing (SQK-LSK114) is currently incompatible with the default setup for wf-transcriptomes.
   Pychopper currently miss-classsifies The reads generated with Direct cDNA Sequencing are not being classified correctly in the analysis workflow, leading to ≥80% data loss of full-read transcripts following analysis with wf-transcriptomes.

   Note: Experienced users may be able to disable Pychopper during wf-transcriptomes analysis setup to circumvent this issue using the infomation available in the wf-transcriptomes GitHub page and the Pychopper GitHub page.
   Please note that deviating from the standard analysis settings can result in changes to the analysis output.

2. Post-basecalling analysis

   There are several options for further analysing your basecalled data:

   1. EPI2ME workflows

   For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME, which are available in the EPI2ME section of the Community. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

   2. Research analysis tools

   Oxford Nanopore Technologies' Research division has created a number of analysis tools, that are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

   3. Community-developed analysis tools

   If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

1. After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at 2-8°C.

   The Flow Cell Wash Kit protocol is available on the Nanopore Community.

2. Tip We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
3. Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.

   Instructions for returning flow cells can be found here.

   Note: All flow cells must be flushed with deionised water before returning the product.

4. Important If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation).	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.

11. Guppy – no input .fast5 was found or basecalled

    Observation	Possible cause	Comments and actions
    No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
    No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

12. Guppy – no Pass or Fail folders were generated after basecalling

    Observation	Possible cause	Comments and actions
    No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

13. Guppy – unusually slow processing on a GPU computer

    Observation	Possible cause	Comments and actions
    Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.