Version for device: Flongle
Other available device versions: MinION
Overview of the protocol
This kit has now been discontinued and we recommend all customers upgrade to the latest chemistry for their relevant kit which is available on the Store. For further information on please see the product update page.
This kit is recommended for users who:
This protocol describes how to carry out rapid barcoding of genomic DNA using the Rapid Barcoding Sequencing Kit (SQK-RBK004).
Steps in the sequencing workflow:
Prepare for your experiment
You will need to:
- Extract your DNA, and check its length, quantity and purity.
The quality checks performed during the protocol are essential in ensuring experimental success.
- Ensure you have your sequencing kit, the correct equipment and third-party reagents
- Download the software for acquiring and analysing your data
- Check your flow cell to ensure it has enough pores for a good sequencing run
Library preparation
You will need to:
- Tagment your DNA using the Fragmentation Mix RB in the kit; this simultaneously attaches a pair of barcodes to the fragments
- Pool the barcoded samples
- Attach sequencing adapters supplied in the kit to the DNA ends
- Prime the flow cell, and load your DNA library into the flow cell
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
- Start the EPI2ME software and select a workflow for barcoding
This protocol should only be used in combination with:
There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flow Cell Flush, and Library Beads or Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle Flow Cell system (MinION and PromethION are not impacted by this).
To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.
To load a library onto your Flongle Flow Cell, you will need to use the following components:
Sequencing kit components
Flongle Sequencing Expansion (EXP-FSE002) components
Oxford Nanopore Technologies deem the useful life of the Flongle Sequencing Expansion to be 6 months from receipt by the customer.
It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.
Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
---|---|---|---|---|
Fragmentation Mix | RB01-RB12 | Clear | 12, each vial with a unique barcode | 20 |
Rapid Adapter | RAP | Green | 1 | 10 |
Loading Beads | LB | Pink | 1 | 360 |
Sequencing Buffer | SQB | Red | 1 | 300 |
Component | Sequence |
---|---|
RB01 | AAGAAAGTTGTCGGTGTCTTTGTG |
RB02 | TCGATTCCGTTTGTAGTCGTCTGT |
RB03 | GAGTCTTGTGTCCCAGTTACCAGG |
RB04 | TTCGGATTCTATCGTGTTTCCCTA |
RB05 | CTTGTCCAGGGTTTGTGTAACCTT |
RB06 | TTCTCGCAAAGGCAGAAAGTAGTC |
RB07 | GTGTTACCGTGGGAATGAATCCTT |
RB08 | TTCAGGGAACAAACCAAGTTACGT |
RB09 | AACTAGGCACAGCGAGTCTTGGTT |
RB10 | AAGCGTTGAAACCTTTGTCCTCTC |
RB11 | GTTTCATCTATCGGAGGGAATGGA |
RB12 | CAGGTAGAAAGAAGCAGAATCGGA |
Name | Acronym | Cap colour | Number of vials | Fill volume per vial (µl) |
---|---|---|---|---|
Sequencing Buffer II | SBII | Blue | 1 | 180 |
Loading Beads II | LBII | Blue | 1 | 120 |
Loading Solution | LS | Blue | 1 | 120 |
Flush Buffer | FB | Blue | 2 | 702 |
Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.
Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
---|---|---|---|---|
Flush Buffer | FB | Blue | 6 | 1,170 |
Flush Tether | FLT | Purple | 1 | 200 |
Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
---|---|---|---|---|
Short Fragment Buffer | SFB | Grey | 4 | 1,800 |
This kit contains reagents to be used with any remaining barcodes to load another six sequencing libraries.
Reagent | Acronym | Cap colour | No. of vials | Fill volume per vial (µl) |
---|---|---|---|---|
Rapid Adapter | RAP | Green | 1 | 10 |
Sequencing Tether | SQT | Purple | 1 | 10 |
Loading Beads | LB | Pink | 1 | 360 |
Sequencing Buffer | SQB | Red | 1 | 300 |
There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flow Cell Flush, and Library Beads or Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle Flow Cell system (MinION and PromethION are not impacted by this).
To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.
To load a library onto your Flongle Flow Cell, you will need to use the following components:
Sequencing kit components
Flongle Sequencing Expansion (EXP-FSE002) components
Oxford Nanopore Technologies deem the useful life of the Flongle Sequencing Expansion to be 6 months from receipt by the customer.
Reagent | 1. Thaw at room temperature | 2. Briefly spin down | 3. Mix well by pipetting |
---|---|---|---|
Fragmentation Mix RB01-12 | Not frozen | ✓ | ✓ |
Rapid Adapter (RAP) | Not frozen | ✓ | ✓ |
Sequencing Buffer (SQB) | ✓ | ✓ | ✓* |
Loading Beads (LB) | ✓ | ✓ | Mix by pipetting or vortexing immediately before use |
Sequencing Tether (SQT) | ✓ | ✓ | ✓ |
*Vortexing, followed by a brief spin in a microfuge, is recommended for Sequencing Buffer (SQB).
Reagent | Volume |
---|---|
200 ng template DNA | 3.75 μl |
Fragmentation Mix RB01-12 (one for each sample) | 1.25 μl |
Total | 5 μl |
Loading the Flongle flow cell
There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flow Cell Flush, and Library Beads or Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle Flow Cell system (MinION and PromethION are not impacted by this).
To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.
To load a library onto your Flongle Flow Cell, you will need to use the following components:
Sequencing kit components
Flongle Sequencing Expansion (EXP-FSE002) components
Oxford Nanopore Technologies deem the useful life of the Flongle Sequencing Expansion to be 6 months from receipt by the customer.
The seal tab, air vent, waste channel, drain port and sample port are visible here. The sample port, drain port and air vent only become accessible once the seal tab is peeled back.
The adapter should sit evenly and flat on the MinION Mk1B or GridION platform. This ensures the flow cell assembly is flat during the next stage.
The flow cell should sit evenly and flat inside the adapter, to avoid any bubbles forming inside the fluidic compartments.
This is a modal window.
Beginning of dialog window. Escape will cancel and close the window.
End of dialog window.
This is a modal window. This modal can be closed by pressing the Escape key or activating the close button.
Lift up the seal tab:
Pull the seal tab to open access to the sample port:
Hold the seal tab open by using adhesive on the tab to stick to the MinION Mk 1B lid:
Reagents | Volume |
---|---|
Sequencing Buffer II (SBII) | 15 µl |
Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using. LS can be used instead of LBII when preparing libraries with the Ligation Sequencing Kit (SQK-LSK110) | 10 µl |
DNA library | 5 µl |
Total | 30 µl |
Stick the transparent adhesive tape to the sample port.
Replace the top (Wheel icon section) of the seal tab to its original position.
Data acquisition and basecalling
Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.
MinKNOW can be used and set up to sequence in multiple ways:
For more information on using MinKNOW on a sequencing device, please see the device user manuals:
To start a sequencing run on MinKNOW:
1. Navigate to the start page and click Start sequencing.
2. Fill in your experiment details, such as name and flow cell position and sample ID.
3. Select the sequencing kit used in the library preparation on the Kit page.
4. Configure the sequencing parameters for your sequencing run or keep to the default settings on the Run options and Analysis tabs.
Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.
5. On the Output page, set up the output parameters or keep to the default settings.
6. Click Start on the Review page to start the sequencing run.
After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.
In the Downstream analysis section, we outline further options for analysing your data.
Downstream analysis
There are several options for further analysing your basecalled data:
For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.
Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.
If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.
Issues during DNA/RNA extraction and library preparation
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Observation | Possible cause | Comments and actions |
---|---|---|
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) | The DNA extraction method does not provide the required purity | The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step. |
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. |
RNA has a shorter than expected fragment length | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA. |
Observation | Possible cause | Comments and actions |
---|---|---|
Low recovery | DNA loss due to a lower than intended AMPure beads-to-sample ratio | 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up. |
Low recovery | DNA fragments are shorter than expected | The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. ![]() |
Low recovery after end-prep | The wash step used ethanol <70% | DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage. |
Issues during the sequencing run
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Observation | Possible cause | Comments and actions |
---|---|---|
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | An air bubble was introduced into the nanopore array | After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video. |
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | The flow cell is not correctly inserted into the device | Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION). |
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | Contaminations in the library damaged or blocked the pores | The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Observation | Possible cause | Comments and actions |
---|---|---|
MinKNOW shows "Script failed" | Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance. |
Observation | Possible cause | Comments and actions |
---|---|---|
Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol" |
Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA | Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents. |
Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation | Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters. |
Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming. |
Observation | Possible cause | Comments and actions |
---|---|---|
Shorter than expected read length | Unwanted fragmentation of DNA sample | Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. ![]() 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient. |
Observation | Possible cause | Comments and actions |
---|---|---|
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) ![]() |
Contaminants are present in the sample | Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems. |
Observation | Possible cause | Comments and actions |
---|---|---|
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) | Air bubbles have been introduced into the flow cell | Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice |
Large proportion of inactive/unavailable pores | Certain compounds co-purified with DNA | Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit. |
Large proportion of inactive/unavailable pores | Contaminants are present in the sample | The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Observation | Possible cause | Comments and actions |
---|---|---|
Reduction in sequencing speed and q-score later into the run | For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). | Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell. |
Observation | Possible cause | Comments and actions |
---|---|---|
Temperature fluctuation | The flow cell has lost contact with the device | Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services. |
Observation | Possible cause | Comments and actions |
---|---|---|
MinKNOW shows "Failed to reach target temperature" | The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) | MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control. |
Observation | Possible cause | Comments and actions |
---|---|---|
No input .fast5 was found or basecalled | input_path did not point to the .fast5 file location | The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH. |
No input .fast5 was found or basecalled | The .fast5 files were in a subfolder at the input_path location | To allow Guppy to look into subfolders, add the --recursive flag to the command |
Observation | Possible cause | Comments and actions |
---|---|---|
No Pass or Fail folders were generated after basecalling | The --qscore_filtering flag was not included in the command | The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders. |
Observation | Possible cause | Comments and actions |
---|---|---|
Unusually slow processing on a GPU computer | The --device flag wasn't included in the command | The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command. |
Purchase a MinION Starter Pack from Avantor to get full community access and benefit from:
Already have a Nanopore Community account?
Log in hereRequest a call with our experts for detailed advice on implementing nanopore sequencing.
Request a callVisit our microbial sequencing spotlight page on vwr.com.
Microbial sequencingWe use cookies and similar technologies on our websites to help provide you with the best possible online experience.
By using our sites and apps, you agree that we may store and access cookies and similar technologies on your device.