Rapid sequencing gDNA - barcoding (SQK-RBK004)

Version for device: Flongle

Other available device versions: MinION

1. Important This is a Legacy product

   This kit has now been discontinued and we recommend all customers upgrade to the latest chemistry for their relevant kit which is available on the Store. For further information on please see the product update page.

2. Rapid Barcoding Kit features

   This kit is recommended for users who:

   • Wish to multiplex samples to reduce price per sample
   • Need a PCR-free method of multiplexing to preserve additional information such as base modifications
   • Require a short preparation time
   • Have limited access to laboratory equipment
3. Introduction to the Rapid Barcoding Sequencing Kit

   This protocol describes how to carry out rapid barcoding of genomic DNA using the Rapid Barcoding Sequencing Kit (SQK-RBK004).

   Steps in the sequencing workflow:

   Prepare for your experiment

   You will need to:
   - Extract your DNA, and check its length, quantity and purity.
   The quality checks performed during the protocol are essential in ensuring experimental success.
   - Ensure you have your sequencing kit, the correct equipment and third-party reagents
   - Download the software for acquiring and analysing your data
   - Check your flow cell to ensure it has enough pores for a good sequencing run

   Library preparation

   You will need to:
   - Tagment your DNA using the Fragmentation Mix RB in the kit; this simultaneously attaches a pair of barcodes to the fragments
   - Pool the barcoded samples
   - Attach sequencing adapters supplied in the kit to the DNA ends
   - Prime the flow cell, and load your DNA library into the flow cell

   

   Sequencing and analysis

   You will need to:
   - Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
   - Start the EPI2ME software and select a workflow for barcoding

4. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • Rapid Barcoding Sequencing Kit SQK-RBK004
   • Flongle Sequencing Expansion (EXP-FSE001)
   • Flongle Flow Cell R9.4.1 (FLO-FLG001)
   • RAP Top-Up Kit (EXP-RAP001)
   • Sequencing Auxiliary Vials (EXP-AUX001)

1. Important Flongle Sequencing Expansion

   There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flush Buffer/Flow Cell Flush, and Loading Beads/Library Beads or Loading Solution/Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE001 and EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE001) components

   • Sequencing Buffer II (SBII)
   • Flush Buffer (FB)
   • Loading Beads II (LBII) or Loading Solution (LS)

   Sequencing or Flow Cell Priming Kit components

   • Flush Tether (FLT)

   Flongle Sequencing Expansion (EXP-FSE002) components for Kit 14

   • Sequencing Buffer (SB)
   • Flow Cell Flush (FCF)
   • Library Beads (LIB)
   • Library Solution (LIS)

   Oxford Nanopore Technologies deem the useful life of the Flongle Flow Cell Priming Kit to be 6 months from receipt by the customer.

2. For this protocol, you will need 200 ng high molecular weight genomic DNA.
3. Input DNA

   How to QC your input DNA

   It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

   For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

   Chemical contaminants

   Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

4. Rapid Barcoding Kit (SQK-RBK004) contents

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   Fragmentation Mix	RB01-RB12	Clear	12, each vial with a unique barcode	20
   Rapid Adapter	RAP	Green	1	10
   Loading Beads	LB	Pink	1	360
   Sequencing Buffer	SQB	Red	1	300

5. Rapid Barcoding Kit sequences

   Component	Sequence
   RB01	AAGAAAGTTGTCGGTGTCTTTGTG
   RB02	TCGATTCCGTTTGTAGTCGTCTGT
   RB03	GAGTCTTGTGTCCCAGTTACCAGG
   RB04	TTCGGATTCTATCGTGTTTCCCTA
   RB05	CTTGTCCAGGGTTTGTGTAACCTT
   RB06	TTCTCGCAAAGGCAGAAAGTAGTC
   RB07	GTGTTACCGTGGGAATGAATCCTT
   RB08	TTCAGGGAACAAACCAAGTTACGT
   RB09	AACTAGGCACAGCGAGTCTTGGTT
   RB10	AAGCGTTGAAACCTTTGTCCTCTC
   RB11	GTTTCATCTATCGGAGGGAATGGA
   RB12	CAGGTAGAAAGAAGCAGAATCGGA

6. Flongle Sequencing Expansion (EXP-FSE001) contents

   

   Name	Acronym	Cap colour	Number of vials	Fill volume per vial (µl)
   Sequencing Buffer II	SBII	Blue	1	180
   Loading Beads II	LBII	Blue	1	120
   Loading Solution	LS	Blue	1	120
   Flush Buffer	FB	Blue	2	702

   Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.

7. Important Please note that Oxford Nanopore Technologies deem the useful life of the Flongle Sequencing Expansion (EXP-FSE001) to be 6 months from receipt by the customer.
8. Flow Cell Priming Kit contents (EXP-FLP002)

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   Flush Buffer	FB	Blue	6	1,170
   Flush Tether	FLT	Purple	1	200

9. SFB Expansion contents (EXP-SFB001)

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   Short Fragment Buffer	SFB	Grey	4	1,800

10. The RAP Top-Up Kit (EXP-RAP001) is available to provide enough reagents for another six reactions depending on how the barcodes are used.

    This kit contains reagents to be used with any remaining barcodes to load another six sequencing libraries.

    

    Reagent	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
    Rapid Adapter	RAP	Green	1	10
    Sequencing Tether	SQT	Purple	1	10
    Loading Beads	LB	Pink	1	360
    Sequencing Buffer	SQB	Red	1	300

1. Important Flongle Sequencing Expansion

   There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flush Buffer/Flow Cell Flush, and Loading Beads/Library Beads or Loading Solution/Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE001 and EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE001) components

   • Sequencing Buffer II (SBII)
   • Flush Buffer (FB)
   • Loading Beads II (LBII) or Loading Solution (LS)

   Sequencing or Flow Cell Priming Kit components

   • Flush Tether (FLT)

   Flongle Sequencing Expansion (EXP-FSE002) components for Kit 14

   • Sequencing Buffer (SB)
   • Flow Cell Flush (FCF)
   • Library Beads (LIB)
   • Library Solution (LIS)

   Oxford Nanopore Technologies deem the useful life of the Flongle Flow Cell Priming Kit to be 6 months from receipt by the customer.

2. Thaw kit components at room temperature, spin down briefly using a microfuge and mix by pipetting as indicated by the table below:

   Reagent	1. Thaw at room temperature	2. Briefly spin down	3. Mix well by pipetting
   Fragmentation Mix RB01-12	Not frozen	✓	✓
   Rapid Adapter (RAP)	Not frozen	✓	✓
   Sequencing Buffer (SQB)	✓	✓	✓*
   Loading Beads (LB)	✓	✓	Mix by pipetting or vortexing immediately before use
   Sequencing Tether (SQT)	✓	✓	✓

   *Vortexing, followed by a brief spin in a microfuge, is recommended for Sequencing Buffer (SQB).

3. Prepare the DNA in nuclease-free water
   • Transfer ~200 ng genomic DNA into a 1.5 ml Eppendorf DNA LoBind tube
   • Adjust the volume to 3.75 μl with nuclease-free water
   • Mix by flicking the tube to avoid unwanted shearing
   • Spin down briefly in a microfuge

4. In a 0.2 ml thin-walled PCR tube, mix the following:

   Reagent	Volume
   200 ng template DNA	3.75 μl
   Fragmentation Mix RB01-12 (one for each sample)	1.25 μl
   Total	5 μl

5. Mix gently by flicking the tube, and spin down.
6. Incubate the tube at 30°C for 1 minute and then at 80°C for 1 minute. Briefly put the tube on ice to cool it down.
7. Pool the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.
8. Resuspend the AMPure XP beads by vortexing.
9. To the entire pooled barcoded sample from Step 6, add an equal volume of resuspended AMPure XP beads, and mix by flicking the tube.
10. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
11. Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
12. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.
13. Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
14. Repeat the previous step.
15. Spin down and place the tube back on the magnet. Pipette off any residual 70% ethanol. Briefly allow to dry.
16. Remove the tube from the magnetic rack and resuspend pellet in 6 µl of 10 mM Tris-HCl pH 7.5-8.0 with 50 mM NaCl. Incubate for 2 minutes at room temperature.
17. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
18. Remove and retain 6 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
    • Remove and retain the eluate which contains the DNA in a clean 1.5 ml Eppendorf DNA LoBind tube
    • Dispose of the pelleted beads

19. Optional Action

    Quantify 1 µl of eluted sample using a Qubit fluorometer.
20. Add 0.5 μl of RAP to the tube.
21. Mix gently by flicking the tube, and spin down.
22. Incubate the reaction for 5 minutes at room temperature.
23. Important Following standard input recommendations, the protocol should produce enough final library (adapted DNA in 10 mM Tris-HCl pH 7.5-8.0 with 50 mM NaCl) to load at least two Flongle flow cells. We recommend reserving enough library to load a second Flongle flow cell. We recommend loading 3-20 fmol of this final prepared library onto the flow cell. Loading more than 20 fmol can have a detrimental effect on throughput. Dilute the library in 10 mM Tris-HCl pH 7.5-8.0 with 50 mM NaCl or nuclease-free water up to a final volume of 5 μl.
24. End of Step The prepared library is used for loading into the Flongle flow cell. Store the library on ice until ready to load.

1. Important Flongle Sequencing Expansion

   There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flush Buffer/Flow Cell Flush, and Loading Beads/Library Beads or Loading Solution/Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE001 and EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE001) components

   • Sequencing Buffer II (SBII)
   • Flush Buffer (FB)
   • Loading Beads II (LBII) or Loading Solution (LS)

   Sequencing or Flow Cell Priming Kit components

   • Flush Tether (FLT)

   Flongle Sequencing Expansion (EXP-FSE002) components for Kit 14

   • Sequencing Buffer (SB)
   • Flow Cell Flush (FCF)
   • Library Beads (LIB)
   • Library Solution (LIS)

   Oxford Nanopore Technologies deem the useful life of the Flongle Flow Cell Priming Kit to be 6 months from receipt by the customer.

2. Important Please note that the Sequencing Tether (SQT) tube will NOT be used in this protocol. It is provided in the kit for potential future product compatibility.
3. Important Do NOT touch the reverse side of the Flongle flow cell array or the contact pads on the Flongle adapter. ALWAYS wear gloves when handling Flongle flow cells and adapters to avoid damage to the flow cell or adapter.

   

4. The diagram below shows the components of the Flongle flow cell:

   

   The seal tab, air vent, waste channel, drain port and sample port are visible here. The sample port, drain port and air vent only become accessible once the seal tab is peeled back.

5. Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) and Flush Buffer (FB) from the Flongle Sequencing Expansion and Flush Tether (FLT) from your sequencing kit at room temperature.
6. Mix the Sequencing Buffer II (SBII), Flush Buffer (FB) and Flush Tether (FLT) tubes by vortexing and spin down at room temperature.
7. Place the Flongle adapter into the MinION or one of the five GridION positions.

   The adapter should sit evenly and flat on the MinION Mk1B or GridION platform. This ensures the flow cell assembly is flat during the next stage.

8. Important The adapter needs to be plugged into your device, and the device should be plugged in and powered on before inserting the Flongle flow cell.

   

9. Place the flow cell into the Flongle adapter, and press the flow cell down until you hear a click.

   The flow cell should sit evenly and flat inside the adapter, to avoid any bubbles forming inside the fluidic compartments.

   

10. Important How to prime and load a Flongle flow cell

11. In a fresh 1.5 ml Eppendorf DNA LoBind tube, mix 117 µl of Flush Buffer (FB) with 3 µl of Flush Tether (FLT) and mix by pipetting.
12. Peel back the seal tab from the Flongle flow cell, up to a point where the sample port is exposed, as follows:

    1. Lift up the seal tab:
       
       
       

    2. Pull the seal tab to open access to the sample port:
       
       
       

    3. Hold the seal tab open by using adhesive on the tab to stick to the MinION Mk 1B lid:
       

13. To prime your flow cell with the mix of Flush Buffer (FB) and Flush Tether (FLT) that was prepared earlier, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 pipette tip inside the sample port and slowly dispense the priming fluid into the Flongle flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

    

14. Vortex the vial of Loading Beads II (LBII). Note that the beads settle quickly, so immediately prepare the Sequencing Mix in a fresh 1.5 ml Eppendorf DNA LoBind tube for loading the Flongle, as follows:

    Reagents	Volume
    Sequencing Buffer II (SBII)	15 µl
    Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using. LS can be used instead of LBII when preparing libraries with the Ligation Sequencing Kit (SQK-LSK110)	10 µl
    DNA library	5 µl
    Total	30 µl

15. To add the Sequencing Mix to the flow cell, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 tip inside the sample port and slowly dispense the Sequencing Mix into the flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

    

16. Seal the Flongle flow cell using the adhesive on the seal tab, as follows:

    1. Stick the transparent adhesive tape to the sample port.
       
       
       

    2. Replace the top (Wheel icon section) of the seal tab to its original position.
       

17. Replace the sequencing platform lid.

1. How to start sequencing

   Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

   MinKNOW can be used and set up to sequence in multiple ways:

   • On a computer either direcly or remotely connected to a sequencing device.
   • Directly on a GridION, MinION Mk1C or PromethION 24/48 sequencing device.

   For more information on using MinKNOW on a sequencing device, please see the device user manuals:

   • MinION Mk1C user manual
   • MinION Mk1B user manual
   • GridION user manual

   ---

   To start a sequencing run on MinKNOW:

   1. Navigate to the start page and click Start sequencing.
   

   2. Fill in your experiment details, such as name and flow cell position and sample ID.
   

   3. Select the sequencing kit used in the library preparation on the Kit page.
   

   4. Configure the sequencing parameters for your sequencing run or keep to the default settings on the Run options and Analysis tabs.

   Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

   5. On the Output page, set up the output parameters or keep to the default settings.
   

   6. Click Start on the Review page to start the sequencing run.
   

2. Data analysis after sequencing

   After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

   In the Downstream analysis section, we outline further options for analysing your data.

1. Post-basecalling analysis

   There are several options for further analysing your basecalled data:

   1. EPI2ME workflows

   For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

   2. Research analysis tools

   Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

   3. Community-developed analysis tools

   If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation).	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.

11. Guppy – no input .fast5 was found or basecalled

    Observation	Possible cause	Comments and actions
    No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
    No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

12. Guppy – no Pass or Fail folders were generated after basecalling

    Observation	Possible cause	Comments and actions
    No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

13. Guppy – unusually slow processing on a GPU computer

    Observation	Possible cause	Comments and actions
    Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.