Ligation sequencing gDNA - native barcoding (SQK-LSK109 with EXP-NBD104 and EXP-NBD114)

Version for device: Flongle

Other available device versions: MinION

1. Important This is a Legacy product

   This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.

2. Native Barcoding Expansion 1-12 and 13-24 features

   These kits are recommended for users who:

   • wish to multiplex samples to reduce price per sample
   • need a PCR-free method of multiplexing to preserve additional information such as base modifications
   • want to optimise their sequencing experiment for throughput
   • require control over read length
   • are interested in utilising upstream processes such as size selection or whole genome amplification
3. Introduction to the Native Barcoding protocol

   This protocol describes how to carry out native barcoding of genomic DNA using the Native Barcoding Expansion 1-12 (EXP-NBD104) and 13-24 (EXP-NBD114), in conjunction with the Ligation Sequencing Kit (SQK-LSK109). There are 24 unique barcodes if using both expansion kits, allowing the user to pool up to 24 different samples in one sequencing experiment. It is highly recommended that a Lambda control experiment is completed first to become familiar with the technology.

   Steps in the sequencing workflow:

   Prepare for your experiment

   You will need to:
   - Extract your DNA, and check its length, quantity and purity.
   The quality checks performed during the protocol are essential in ensuring experimental success.
   - Ensure you have your sequencing kit, the correct equipment and third-party reagents
   - Download the software for acquiring and analysing your data
   - Check your flow cell to ensure it has enough pores for a good sequencing run

   Prepare your library

   You will need to:
   - Repair the DNA, and prepare the DNA ends for adapter attachment
   - Ligate Native barcodes supplied in the kit to the DNA ends
   - Ligate sequencing adapters supplied in the kit to the DNA ends
   - Prime the flow cell, and load your DNA library into the flow cell

   

   Sequencing

   You will need to:
   - Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
   - Start the EPI2ME software and select the barcoding workflow

4. Important We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.
5. Important Optional fragmentation and size selection

   By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (25 ng–125 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

   Additionally, we offer several options for size-selecting your DNA sample to remove short fragments - instructions are available in the Size Selection section of Extraction methods.

6. Important Compatibility of this protocol

   This protocol should only be used in combination with:

   • Ligation Sequencing Kit (SQK-LSK109)
   • Native Barcoding Expansions 1-12 (EXP-NBD104) and 13-24 (EXP-NBD114)
   • Flongle Flow Cell R9.4.1 (FLO-FLG001)
   • Flongle Sequencing Expansion (EXP-FSE001)

1. Important Flongle Sequencing Expansion

   There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flush Buffer/Flow Cell Flush, and Loading Beads/Library Beads or Loading Solution/Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE001 and EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE001) components

   • Sequencing Buffer II (SBII)
   • Flush Buffer (FB)
   • Loading Beads II (LBII) or Loading Solution (LS)

   Sequencing or Flow Cell Priming Kit components

   • Flush Tether (FLT)

   Flongle Sequencing Expansion (EXP-FSE002) components for Kit 14

   • Sequencing Buffer (SB)
   • Flow Cell Flush (FCF)
   • Library Beads (LIB)
   • Library Solution (LIS)

   Oxford Nanopore Technologies deem the useful life of the Flongle Flow Cell Priming Kit to be 6 months from receipt by the customer.

2. For this protocol, you will need 250 ng high molecular weight genomic DNA for every sample to be barcoded.

   Although 250 ng (or 25-50 fmol) gDNA is recommended, users can start with lower input quantities (down to 50 ng) if performing DNA fragmentation to increase the number of DNA molecules in the sample, or if amplifying the sample by PCR.

3. Input DNA

   How to QC your input DNA

   It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

   For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

   Chemical contaminants

   Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

4. Ligation Sequencing Kit contents (SQK-LSK109)

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
   DNA CS	DCS	Yellow	1	50
   Adapter Mix	AMX	Green	1	40
   Ligation Buffer	LNB	Clear	1	200
   L Fragment Buffer	LFB	White cap, orange stripe on label	2	1,800
   S Fragment Buffer	SFB	Grey	2	1,800
   Sequencing Buffer	SQB	Red	2	300
   Elution Buffer	EB	Black	1	200
   Loading Beads	LB	Pink	1	360

5. Flow Cell Priming Kit contents (EXP-FLP002)

   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   Flush Buffer	FB	Blue	6	1,170
   Flush Tether	FLT	Purple	1	200

6. Native Barcoding Expansion 1-12 (EXP-NBD104) and 13-24 (EXP-NBD114) contents

   EXP-NBD104 kit contents
   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   Native Barcode 01-12	NB01-12	White	12	20
   Adapter Mix II	AMII	Green	1	40

   
   
   EXP-NBD114 kit contents
   

   Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
   Native Barcode 13-24	NB13-24	White	12	20
   Adapter Mix II	AMII	Green	1	40

7. Flongle Sequencing Expansion (EXP-FSE001) contents

   

   Name	Acronym	Cap colour	Number of vials	Fill volume per vial (µl)
   Sequencing Buffer II	SBII	Blue	1	180
   Loading Beads II	LBII	Blue	1	120
   Loading Solution	LS	Blue	1	120
   Flush Buffer	FB	Blue	2	702

   Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.

8. Important Please note that Oxford Nanopore Technologies deem the useful life of the Flongle Sequencing Expansion (EXP-FSE001) to be 6 months from receipt by the customer.
9. Adapter Mix II Expansion contents (EXP-AMII001)

   

   Name	Acronym	Cap colour	No. of tubes	Fill volume per vial (μl)
   Adapter Mix II	AMII	Green	2	40

10. Adapter Mix II Expansion use

    Protocols that use the Native Barcoding Expansions require 5 μl of AMII per reaction. Native Barcoding Expansions EXP-NBD104/NBD114 and EXP-NBD196 contain sufficient AMII for 6 and 12 reactions, respectively (or 12 and 24 reactions when sequencing on Flongle). This assumes that all barcodes are used in one sequencing run.

    The Adapter Mix II expansion provides additional AMII for customers who are running subsets of barcodes, and allows a further 12 reactions (24 on Flongle).

11. Native barcode sequences

    Below is the full list of our native barcode (NB01-96) sequences. The first 24 unique barcodes are available in the Native Barcoding Kit 24 V14 (SQK-NBD114.24). The Native Barcoding Kit 96 V14 (SQK-NBD114.96) include the first 24 native barcodes, with the additional 72 unique barcodes. The native barcodes are shipped at 640 nM.

    In addition to the barcodes, there are also flanking sequences which add an extra level of context during analysis.

    Barcode flanking sequences:

    Forward sequence: 5' - AAGGTTAA - barcode - CAGCACCT - 3'
    Reverse sequence: 5' - GGTGCTG - barcode - TTAACCTTAGCAAT - 3'

    
    

    Native barcode sequences

    Component	Forward sequence	Reverse sequence
    NB01	CACAAAGACACCGACAACTTTCTT	AAGAAAGTTGTCGGTGTCTTTGTG
    NB02	ACAGACGACTACAAACGGAATCGA	TCGATTCCGTTTGTAGTCGTCTGT
    NB03	CCTGGTAACTGGGACACAAGACTC	GAGTCTTGTGTCCCAGTTACCAGG
    NB04	TAGGGAAACACGATAGAATCCGAA	TTCGGATTCTATCGTGTTTCCCTA
    NB05	AAGGTTACACAAACCCTGGACAAG	CTTGTCCAGGGTTTGTGTAACCTT
    NB06	GACTACTTTCTGCCTTTGCGAGAA	TTCTCGCAAAGGCAGAAAGTAGTC
    NB07	AAGGATTCATTCCCACGGTAACAC	GTGTTACCGTGGGAATGAATCCTT
    NB08	ACGTAACTTGGTTTGTTCCCTGAA	TTCAGGGAACAAACCAAGTTACGT
    NB09	AACCAAGACTCGCTGTGCCTAGTT	AACTAGGCACAGCGAGTCTTGGTT
    NB10	GAGAGGACAAAGGTTTCAACGCTT	AAGCGTTGAAACCTTTGTCCTCTC
    NB11	TCCATTCCCTCCGATAGATGAAAC	GTTTCATCTATCGGAGGGAATGGA
    NB12	TCCGATTCTGCTTCTTTCTACCTG	CAGGTAGAAAGAAGCAGAATCGGA
    NB13	AGAACGACTTCCATACTCGTGTGA	TCACACGAGTATGGAAGTCGTTCT
    NB14	AACGAGTCTCTTGGGACCCATAGA	TCTATGGGTCCCAAGAGACTCGTT
    NB15	AGGTCTACCTCGCTAACACCACTG	CAGTGGTGTTAGCGAGGTAGACCT
    NB16	CGTCAACTGACAGTGGTTCGTACT	AGTACGAACCACTGTCAGTTGACG
    NB17	ACCCTCCAGGAAAGTACCTCTGAT	ATCAGAGGTACTTTCCTGGAGGGT
    NB18	CCAAACCCAACAACCTAGATAGGC	GCCTATCTAGGTTGTTGGGTTTGG
    NB19	GTTCCTCGTGCAGTGTCAAGAGAT	ATCTCTTGACACTGCACGAGGAAC
    NB20	TTGCGTCCTGTTACGAGAACTCAT	ATGAGTTCTCGTAACAGGACGCAA
    NB21	GAGCCTCTCATTGTCCGTTCTCTA	TAGAGAACGGACAATGAGAGGCTC
    NB22	ACCACTGCCATGTATCAAAGTACG	CGTACTTTGATACATGGCAGTGGT
    NB23	CTTACTACCCAGTGAACCTCCTCG	CGAGGAGGTTCACTGGGTAGTAAG
    NB24	GCATAGTTCTGCATGATGGGTTAG	CTAACCCATCATGCAGAACTATGC
    NB25	GTAAGTTGGGTATGCAACGCAATG	CATTGCGTTGCATACCCAACTTAC
    NB26	CATACAGCGACTACGCATTCTCAT	ATGAGAATGCGTAGTCGCTGTATG
    NB27	CGACGGTTAGATTCACCTCTTACA	TGTAAGAGGTGAATCTAACCGTCG
    NB28	TGAAACCTAAGAAGGCACCGTATC	GATACGGTGCCTTCTTAGGTTTCA
    NB29	CTAGACACCTTGGGTTGACAGACC	GGTCTGTCAACCCAAGGTGTCTAG
    NB30	TCAGTGAGGATCTACTTCGACCCA	TGGGTCGAAGTAGATCCTCACTGA
    NB31	TGCGTACAGCAATCAGTTACATTG	CAATGTAACTGATTGCTGTACGCA
    NB32	CCAGTAGAAGTCCGACAACGTCAT	ATGACGTTGTCGGACTTCTACTGG
    NB33	CAGACTTGGTACGGTTGGGTAACT	AGTTACCCAACCGTACCAAGTCTG
    NB34	GGACGAAGAACTCAAGTCAAAGGC	GCCTTTGACTTGAGTTCTTCGTCC
    NB35	CTACTTACGAAGCTGAGGGACTGC	GCAGTCCCTCAGCTTCGTAAGTAG
    NB36	ATGTCCCAGTTAGAGGAGGAAACA	TGTTTCCTCCTCTAACTGGGACAT
    NB37	GCTTGCGATTGATGCTTAGTATCA	TGATACTAAGCATCAATCGCAAGC
    NB38	ACCACAGGAGGACGATACAGAGAA	TTCTCTGTATCGTCCTCCTGTGGT
    NB39	CCACAGTGTCAACTAGAGCCTCTC	GAGAGGCTCTAGTTGACACTGTGG
    NB40	TAGTTTGGATGACCAAGGATAGCC	GGCTATCCTTGGTCATCCAAACTA
    NB41	GGAGTTCGTCCAGAGAAGTACACG	CGTGTACTTCTCTGGACGAACTCC
    NB42	CTACGTGTAAGGCATACCTGCCAG	CTGGCAGGTATGCCTTACACGTAG
    NB43	CTTTCGTTGTTGACTCGACGGTAG	CTACCGTCGAGTCAACAACGAAAG
    NB44	AGTAGAAAGGGTTCCTTCCCACTC	GAGTGGGAAGGAACCCTTTCTACT
    NB45	GATCCAACAGAGATGCCTTCAGTG	CACTGAAGGCATCTCTGTTGGATC
    NB46	GCTGTGTTCCACTTCATTCTCCTG	CAGGAGAATGAAGTGGAACACAGC
    NB47	GTGCAACTTTCCCACAGGTAGTTC	GAACTACCTGTGGGAAAGTTGCAC
    NB48	CATCTGGAACGTGGTACACCTGTA	TACAGGTGTACCACGTTCCAGATG
    NB49	ACTGGTGCAGCTTTGAACATCTAG	CTAGATGTTCAAAGCTGCACCAGT
    NB50	ATGGACTTTGGTAACTTCCTGCGT	ACGCAGGAAGTTACCAAAGTCCAT
    NB51	GTTGAATGAGCCTACTGGGTCCTC	GAGGACCCAGTAGGCTCATTCAAC
    NB52	TGAGAGACAAGATTGTTCGTGGAC	GTCCACGAACAATCTTGTCTCTCA
    NB53	AGATTCAGACCGTCTCATGCAAAG	CTTTGCATGAGACGGTCTGAATCT
    NB54	CAAGAGCTTTGACTAAGGAGCATG	CATGCTCCTTAGTCAAAGCTCTTG
    NB55	TGGAAGATGAGACCCTGATCTACG	CGTAGATCAGGGTCTCATCTTCCA
    NB56	TCACTACTCAACAGGTGGCATGAA	TTCATGCCACCTGTTGAGTAGTGA
    NB57	GCTAGGTCAATCTCCTTCGGAAGT	ACTTCCGAAGGAGATTGACCTAGC
    NB58	CAGGTTACTCCTCCGTGAGTCTGA	TCAGACTCACGGAGGAGTAACCTG
    NB59	TCAATCAAGAAGGGAAAGCAAGGT	ACCTTGCTTTCCCTTCTTGATTGA
    NB60	CATGTTCAACCAAGGCTTCTATGG	CCATAGAAGCCTTGGTTGAACATG
    NB61	AGAGGGTACTATGTGCCTCAGCAC	GTGCTGAGGCACATAGTACCCTCT
    NB62	CACCCACACTTACTTCAGGACGTA	TACGTCCTGAAGTAAGTGTGGGTG
    NB63	TTCTGAAGTTCCTGGGTCTTGAAC	GTTCAAGACCCAGGAACTTCAGAA
    NB64	GACAGACACCGTTCATCGACTTTC	GAAAGTCGATGAACGGTGTCTGTC
    NB65	TTCTCAGTCTTCCTCCAGACAAGG	CCTTGTCTGGAGGAAGACTGAGAA
    NB66	CCGATCCTTGTGGCTTCTAACTTC	GAAGTTAGAAGCCACAAGGATCGG
    NB67	GTTTGTCATACTCGTGTGCTCACC	GGTGAGCACACGAGTATGACAAAC
    NB68	GAATCTAAGCAAACACGAAGGTGG	CCACCTTCGTGTTTGCTTAGATTC
    NB69	TACAGTCCGAGCCTCATGTGATCT	AGATCACATGAGGCTCGGACTGTA
    NB70	ACCGAGATCCTACGAATGGAGTGT	ACACTCCATTCGTAGGATCTCGGT
    NB71	CCTGGGAGCATCAGGTAGTAACAG	CTGTTACTACCTGATGCTCCCAGG
    NB72	TAGCTGACTGTCTTCCATACCGAC	GTCGGTATGGAAGACAGTCAGCTA
    NB73	AAGAAACAGGATGACAGAACCCTC	GAGGGTTCTGTCATCCTGTTTCTT
    NB74	TACAAGCATCCCAACACTTCCACT	AGTGGAAGTGTTGGGATGCTTGTA
    NB75	GACCATTGTGATGAACCCTGTTGT	ACAACAGGGTTCATCACAATGGTC
    NB76	ATGCTTGTTACATCAACCCTGGAC	GTCCAGGGTTGATGTAACAAGCAT
    NB77	CGACCTGTTTCTCAGGGATACAAC	GTTGTATCCCTGAGAAACAGGTCG
    NB78	AACAACCGAACCTTTGAATCAGAA	TTCTGATTCAAAGGTTCGGTTGTT
    NB79	TCTCGGAGATAGTTCTCACTGCTG	CAGCAGTGAGAACTATCTCCGAGA
    NB80	CGGATGAACATAGGATAGCGATTC	GAATCGCTATCCTATGTTCATCCG
    NB81	CCTCATCTTGTGAAGTTGTTTCGG	CCGAAACAACTTCACAAGATGAGG
    NB82	ACGGTATGTCGAGTTCCAGGACTA	TAGTCCTGGAACTCGACATACCGT
    NB83	TGGCTTGATCTAGGTAAGGTCGAA	TTCGACCTTACCTAGATCAAGCCA
    NB84	GTAGTGGACCTAGAACCTGTGCCA	TGGCACAGGTTCTAGGTCCACTAC
    NB85	AACGGAGGAGTTAGTTGGATGATC	GATCATCCAACTAACTCCTCCGTT
    NB86	AGGTGATCCCAACAAGCGTAAGTA	TACTTACGCTTGTTGGGATCACCT
    NB87	TACATGCTCCTGTTGTTAGGGAGG	CCTCCCTAACAACAGGAGCATGTA
    NB88	TCTTCTACTACCGATCCGAAGCAG	CTGCTTCGGATCGGTAGTAGAAGA
    NB89	ACAGCATCAATGTTTGGCTAGTTG	CAACTAGCCAAACATTGATGCTGT
    NB90	GATGTAGAGGGTACGGTTTGAGGC	GCCTCAAACCGTACCCTCTACATC
    NB91	GGCTCCATAGGAACTCACGCTACT	AGTAGCGTGAGTTCCTATGGAGCC
    NB92	TTGTGAGTGGAAAGATACAGGACC	GGTCCTGTATCTTTCCACTCACAA
    NB93	AGTTTCCATCACTTCAGACTTGGG	CCCAAGTCTGAAGTGATGGAAACT
    NB94	GATTGTCCTCAAACTGCCACCTAC	GTAGGTGGCAGTTTGAGGACAATC
    NB95	CCTGTCTGGAAGAAGAATGGACTT	AAGTCCATTCTTCTTCCAGACAGG
    NB96	CTGAACGGTCATAGAGTCCACCAT	ATGGTGGACTCTATGACCGTTCAG

1. MinION Mk1B IT requirements

   Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION Mk1B IT Requirements document.

2. MinION Mk1C IT requirements

   The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. Read more in the MinION Mk1C IT requirements document.

3. Software for nanopore sequencing

   MinKNOW

   The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

   For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

   EPI2ME (optional)

   The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

   For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

4. Check your flow cell

   We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

   Flow cell	Minimum number of active pores covered by warranty
   Flongle Flow Cell	50
   MinION/GridION Flow Cell	800
   PromethION Flow Cell	5000

1. Important Flongle Sequencing Expansion

   There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flush Buffer/Flow Cell Flush, and Loading Beads/Library Beads or Loading Solution/Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE001 and EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE001) components

   • Sequencing Buffer II (SBII)
   • Flush Buffer (FB)
   • Loading Beads II (LBII) or Loading Solution (LS)

   Sequencing or Flow Cell Priming Kit components

   • Flush Tether (FLT)

   Flongle Sequencing Expansion (EXP-FSE002) components for Kit 14

   • Sequencing Buffer (SB)
   • Flow Cell Flush (FCF)
   • Library Beads (LIB)
   • Library Solution (LIS)

   Oxford Nanopore Technologies deem the useful life of the Flongle Flow Cell Priming Kit to be 6 months from receipt by the customer.

2. Important Optional fragmentation and size selection

   By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (25 ng–125 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

   Additionally, we offer several options for size-selecting your DNA sample to remove short fragments - instructions are available in the Size Selection section of Extraction methods.

3. Prepare the NEBNext FFPE DNA Repair Mix and NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer’s instructions, and place on ice.

   For optimal performance, NEB recommend the following:

   1. Thaw all reagents on ice.

   2. Flick and/or invert the reagent tubes to ensure they are well mixed.
      
      Note: Do not vortex the FFPE DNA Repair Mix or Ultra II End Prep Enzyme Mix.

   3. Always spin down tubes before opening for the first time each day.

   4. The Ultra II End Prep Buffer and FFPE DNA Repair Buffer may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for 30 seconds to solubilise any precipitate.
      
      Note: It is important the buffers are mixed well by vortexing.

   5. The FFPE DNA Repair Buffer may have a yellow tinge and is fine to use if yellow.

4. Prepare the DNA in nuclease-free water
   • Transfer 250 ng genomic DNA into a 1.5 ml Eppendorf DNA LoBind tube
   • Adjust the volume to 24 μl with nuclease-free water
   • Mix thoroughly by flicking the tube
   • Spin down briefly in a microfuge

5. In a 0.2 ml thin-walled PCR tube, mix the following:

   Reagent	Volume
   DNA	24 µl
   NEBNext FFPE DNA Repair Buffer	1.75 µl
   Ultra II End-prep reaction buffer	1.75 µl
   Ultra II End-prep enzyme mix	1.5 µl
   NEBNext FFPE DNA Repair Mix	1 µl
   Total	30 µl

6. Ensure the components are thoroughly mixed by pipetting, and spin down.
7. Using a thermal cycler, incubate at 20°C for 5 minutes and 65°C for 5 minutes.
8. Transfer the DNA sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
9. Important AMPure XP bead clean-up

   It is recommended that the repaired/end-prepped DNA sample is subjected to the following clean-up with AMPure XP beads. This clean-up can be omitted for simplicity and to reduce library preparation time. However, it has been observed that omission of this clean-up can: reduce subsequent adapter ligation efficiency, increase the prevalence of chimeric reads, and lead to an increase in pores being unavailable for sequencing. If omitting the clean-up step, proceed to the next section.

10. Resuspend the AMPure XP beads by vortexing.
11. Add 30 µl of resuspended AMPure XP beads to the end-prep reaction and mix by flicking the tube.
12. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
13. Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
14. Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.
15. Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
16. Repeat the previous step.
17. Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
18. Remove the tube from the magnetic rack and resuspend the pellet in 12.5 µl nuclease-free water. Incubate for 2 minutes at room temperature.
19. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
20. Remove and retain 12.5 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
21. Quantify 1 µl of eluted sample using a Qubit fluorometer.
22. End of Step Take forward the repaired and end-prepped DNA into the native barcode ligation step. However, at this point it is also possible to store the sample at 4°C overnight.

1. Thaw the native barcodes at room temperature. Use one barcode per sample. Individually mix the barcodes by pipetting, spin down, and place them on ice.
2. Select a unique barcode for every sample to be run together on the same flow cell, from the provided 24 barcodes. Up to 24 samples can be barcoded and combined in one experiment.
3. Dilute 125 ng of each end-prepped sample to be barcoded to 11.25 µl in nuclease-free water.
4. Add the reagents in the order given below, mixing by flicking the tube between each sequential addition:

   Reagent	Volume
   125 ng end-prepped DNA	11.25 µl
   Native Barcode	1.25 µl
   Blunt/TA Ligase Master Mix	12.5 µl
   Total	25 µl

5. Mix well by pipetting using wide-bore pipette tips. Alternatively, if you are concerned about preserving the integrity of very long DNA fragments, mix gently by flicking the tube, and spin down.
6. Incubate the reaction for 10 minutes at room temperature.
7. Resuspend the AMPure XP beads by vortexing.
8. Add 25 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.
9. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
10. Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
11. Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
12. Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
13. Repeat the previous step.
14. Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
15. Remove the tube from the magnetic rack and resuspend the pellet in 13 µl nuclease-free water. Incubate for 2 minutes at room temperature.
16. Pellet the beads on a magnet until the eluate is clear and colourless.
17. Remove and retain 13 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
18. Quantify 1 µl of eluted sample using a Qubit fluorometer.
19. Important Please first refer to the ligation step below to ensure that the library is diluted to the correct volume.
20. Pool equimolar amounts of each barcoded sample into a DNA LoBind 1.5 ml Eppendorf tube, ensuring that sufficient sample is combined to produce a pooled sample of 250 ng total.
21. Quantify 1 µl of pooled and barcoded DNA using a Qubit fluorometer.
22. Dilute 250 ng pooled sample to 32.5 µl in nuclease-free water.
23. Optional Action

    If 250 ng of pooled sample exceeds 32.5 µl in volume, perform an AMPure clean-up with 2.5x Agencourt AMPure XP beads to pooled sample volume, eluting in 32.5 µl of nuclease-free water.
24. End of Step Take forward the pooled samples into the next step. However, at this point it is also possible to store the sample at 4°C overnight.

1. Adapter Mix II Expansion use

   Protocols that use the Native Barcoding Expansions require 5 μl of AMII per reaction. Native Barcoding Expansions EXP-NBD104/NBD114 and EXP-NBD196 contain sufficient AMII for 6 and 12 reactions, respectively (or 12 and 24 reactions when sequencing on Flongle). This assumes that all barcodes are used in one sequencing run.

   The Adapter Mix II expansion provides additional AMII for customers who are running subsets of barcodes, and allows a further 12 reactions (24 on Flongle).

2. Thaw the Elution Buffer (EB) and NEBNext Quick Ligation Reaction Buffer (5x) at room temperature, mix by vortexing, spin down and place on ice. Check the contents of each tube are clear of any precipitate.
3. Spin down the T4 Ligase and the Adapter Mix II (AMII), and place on ice.
4. Important Depending on the wash buffer (LFB or SFB) used, the clean-up step after adapter ligation is designed to either enrich for DNA fragments of >3 kb, or purify all fragments equally.
   • To enrich for DNA fragments of 3 kb or longer, use Long Fragment Buffer (LFB)
   • To retain DNA fragments of all sizes, use Short Fragment Buffer (SFB)
5. To enrich for DNA fragments of 3 kb or longer, thaw one tube of Long Fragment Buffer (LFB) at room temperature, mix by vortexing, spin down and place on ice.
6. To retain DNA fragments of all sizes, thaw one tube of Short Fragment Buffer (SFB) at room temperature, mix by vortexing, spin down and place on ice.
7. Taking the pooled and barcoded DNA, perform adapter ligation as follows, mixing by flicking the tube between each sequential addition.

   Reagent	Volume
   250 ng pooled barcoded sample	32.5 µl
   Adapter Mix II (AMII)	2.5 µl
   NEBNext Quick Ligation Reaction Buffer (5X)	10 µl
   Quick T4 DNA Ligase	5 µl
   Total	50 µl

8. Ensure the components are thoroughly mixed by pipetting, and spin down.
9. Incubate the reaction for 10 minutes at room temperature.
10. Resuspend the AMPure XP beads by vortexing.
11. Add 25 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.
12. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
13. Place on a magnetic rack, allow beads to pellet and pipette off supernatant.
14. Wash the beads by adding either 125 μl Long Fragment Buffer (LFB) or 125 μl Short Fragment Buffer (SFB). Flick the beads to resuspend, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.
15. Repeat the previous step.
16. Spin down and place the tube back on the magnet. Pipette off any residual supernatant. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
17. Remove the tube from the magnetic rack and resuspend pellet in 7 µl Elution Buffer (EB). Incubate for 10 minutes at room temperature. For high molecular weight DNA, incubating at 37° C can improve the recovery of long fragments.
18. Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
19. Remove and retain 7 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

    Dispose of the pelleted beads

20. Quantify 1 µl of eluted sample using a Qubit fluorometer.
21. End of Step The prepared library is used for loading onto the flow cell. Store the library on ice until ready to load.
22. Important Following standard input recommendations, the protocol should produce enough final library (adapted DNA in EB) to load at least two Flongle flow cells. We recommend reserving enough library to load a second Flongle flow cell. We recommend loading 3-20 fmol of this final prepared library onto the flow cell. Loading more than 20 fmol can have a detrimental effect on throughput. Dilute the library in EB or nuclease-free water up to a final volume of 5 μl.
23. Tip Library storage recommendations

    We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short term storage or repeated use, for example, reloading flow cells between washes.
    For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.
    For further information, please refer to the DNA library stability Know-How document.

24. Optional Action

    If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

    Additional buffer for doing this can be found in the Sequencing Auxiliary Vials expansion (EXP-AUX001), available to purchase separately. This expansion also contains additional vials of Sequencing Buffer (SQB) and Loading Beads (LB), required for loading the libraries onto flow cells.

1. Important Flongle Sequencing Expansion

   There are three buffers that come into direct contact with a flow cell at the point of loading (Sequencing Buffer, Flush Buffer/Flow Cell Flush, and Loading Beads/Library Beads or Loading Solution/Library Solution). We have found that there is a very low level of contaminants seeping out of the plastic vials that contain these buffers, and this impacts the robustness of the Flongle flow cell system (MinION and PromethION are not impacted by this).

   

   To rapidly deploy this to Flongle users, we have produced a Flongle Sequencing Expansion (EXP-FSE001 and EXP-FSE002), which can perform 12 Flongle flow cell loads in total. The buffers in the Flongle Sequencing Expansion are shipped in glass vials to avoid the contaminant seeping issue. It is important to use these buffers when using Flongle Flow Cells.

   To load a library onto your Flongle flow cell, you will need to use the following components:

   Flongle Sequencing Expansion (EXP-FSE001) components

   • Sequencing Buffer II (SBII)
   • Flush Buffer (FB)
   • Loading Beads II (LBII) or Loading Solution (LS)

   Sequencing or Flow Cell Priming Kit components

   • Flush Tether (FLT)

   Flongle Sequencing Expansion (EXP-FSE002) components for Kit 14

   • Sequencing Buffer (SB)
   • Flow Cell Flush (FCF)
   • Library Beads (LIB)
   • Library Solution (LIS)

   Oxford Nanopore Technologies deem the useful life of the Flongle Flow Cell Priming Kit to be 6 months from receipt by the customer.

2. Important Please note that the Sequencing Tether (SQT) tube will NOT be used in this protocol. It is provided in the kit for potential future product compatibility.
3. Important Do NOT touch the reverse side of the Flongle flow cell array or the contact pads on the Flongle adapter. ALWAYS wear gloves when handling Flongle flow cells and adapters to avoid damage to the flow cell or adapter.

   

4. The diagram below shows the components of the Flongle flow cell:

   

   The seal tab, air vent, waste channel, drain port and sample port are visible here. The sample port, drain port and air vent only become accessible once the seal tab is peeled back.

5. Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) and Flush Buffer (FB) from the Flongle Sequencing Expansion and Flush Tether (FLT) from your sequencing kit at room temperature.
6. Mix the Sequencing Buffer II (SBII), Flush Buffer (FB) and Flush Tether (FLT) tubes by vortexing and spin down at room temperature.
7. Place the Flongle adapter into the MinION or one of the five GridION positions.

   The adapter should sit evenly and flat on the MinION Mk1B or GridION platform. This ensures the flow cell assembly is flat during the next stage.

8. Important The adapter needs to be plugged into your device, and the device should be plugged in and powered on before inserting the Flongle flow cell.

   

9. Place the flow cell into the Flongle adapter, and press the flow cell down until you hear a click.

   The flow cell should sit evenly and flat inside the adapter, to avoid any bubbles forming inside the fluidic compartments.

   

10. Important How to prime and load a Flongle flow cell

11. In a fresh 1.5 ml Eppendorf DNA LoBind tube, mix 117 µl of Flush Buffer (FB) with 3 µl of Flush Tether (FLT) and mix by pipetting.
12. Peel back the seal tab from the Flongle flow cell, up to a point where the sample port is exposed, as follows:

    1. Lift up the seal tab:
       
       
       

    2. Pull the seal tab to open access to the sample port:
       
       
       

    3. Hold the seal tab open by using adhesive on the tab to stick to the MinION Mk 1B lid:
       

13. To prime your flow cell with the mix of Flush Buffer (FB) and Flush Tether (FLT) that was prepared earlier, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 pipette tip inside the sample port and slowly dispense the priming fluid into the Flongle flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

    

14. Vortex the vial of Loading Beads II (LBII). Note that the beads settle quickly, so immediately prepare the Sequencing Mix in a fresh 1.5 ml Eppendorf DNA LoBind tube for loading the Flongle, as follows:

    Reagents	Volume
    Sequencing Buffer II (SBII)	15 µl
    Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using. LS can be used instead of LBII when preparing libraries with the Ligation Sequencing Kit (SQK-LSK110)	10 µl
    DNA library	5 µl
    Total	30 µl

15. To add the Sequencing Mix to the flow cell, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 tip inside the sample port and slowly dispense the Sequencing Mix into the flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

    

16. Seal the Flongle flow cell using the adhesive on the seal tab, as follows:

    1. Stick the transparent adhesive tape to the sample port.
       
       
       

    2. Replace the top (Wheel icon section) of the seal tab to its original position.
       

17. Replace the sequencing platform lid.

1. How to start sequencing

   Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

   MinKNOW can be used and set up to sequence in multiple ways:

   • On a computer either direcly or remotely connected to a sequencing device.
   • Directly on a GridION, MinION Mk1C or PromethION 24/48 sequencing device.

   For more information on using MinKNOW on a sequencing device, please see the device user manuals:

   • MinION Mk1C user manual
   • MinION Mk1B user manual
   • GridION user manual

   ---

   To start a sequencing run on MinKNOW:

   1. Navigate to the start page and click Start sequencing.
   

   2. Fill in your experiment details, such as name and flow cell position and sample ID.
   

   3. Select the sequencing kit used in the library preparation on the Kit page.
   

   4. Configure the sequencing parameters for your sequencing run or keep to the default settings on the Run options and Analysis tabs.

   Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

   5. On the Output page, set up the output parameters or keep to the default settings.
   

   6. Click Start on the Review page to start the sequencing run.
   

2. Data analysis after sequencing

   After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

   In the Downstream analysis section, we outline further options for analysing your data.

1. Post-basecalling analysis

   There are several options for further analysing your basecalled data:

   1. EPI2ME workflows

   For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

   2. Research analysis tools

   Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

   3. Community-developed analysis tools

   If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Low sample quality

   Observation	Possible cause	Comments and actions
   Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2)	The DNA extraction method does not provide the required purity	The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step.
   Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel)	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
   RNA has a shorter than expected fragment length	The RNA degraded during extraction	Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

3. Low DNA recovery after AMPure bead clean-up

   Observation	Possible cause	Comments and actions
   Low recovery	DNA loss due to a lower than intended AMPure beads-to-sample ratio	1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
   Low recovery	DNA fragments are shorter than expected	The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use.
   Low recovery after end-prep	The wash step used ethanol <70%	DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

1. Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

   We also have an FAQ section available on the Nanopore Community Support section.

   If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

2. Fewer pores at the start of sequencing than after Flow Cell Check

   Observation	Possible cause	Comments and actions
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	An air bubble was introduced into the nanopore array	After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	The flow cell is not correctly inserted into the device	Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
   MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check	Contaminations in the library damaged or blocked the pores	The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

3. MinKNOW script failed

   Observation	Possible cause	Comments and actions
   MinKNOW shows "Script failed"		Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

4. Pore occupancy below 40%

   Observation	Possible cause	Comments and actions
   Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
   Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
   Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

5. Shorter than expected read length

   Observation	Possible cause	Comments and actions
   Shorter than expected read length	Unwanted fragmentation of DNA sample	Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented. 3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

6. Large proportion of unavailable pores

   Observation	Possible cause	Comments and actions
   Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time.	Contaminants are present in the sample	Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

7. Large proportion of inactive pores

   Observation	Possible cause	Comments and actions
   Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged)	Air bubbles have been introduced into the flow cell	Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
   Large proportion of inactive/unavailable pores	Certain compounds co-purified with DNA	Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
   Large proportion of inactive/unavailable pores	Contaminants are present in the sample	The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

8. Reduction in sequencing speed and q-score later into the run

   Observation	Possible cause	Comments and actions
   Reduction in sequencing speed and q-score later into the run	For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation).	Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

9. Temperature fluctuation

   Observation	Possible cause	Comments and actions
   Temperature fluctuation	The flow cell has lost contact with the device	Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

10. Failed to reach target temperature

    Observation	Possible cause	Comments and actions
    MinKNOW shows "Failed to reach target temperature"	The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating)	MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control.

11. Guppy – no input .fast5 was found or basecalled

    Observation	Possible cause	Comments and actions
    No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
    No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

12. Guppy – no Pass or Fail folders were generated after basecalling

    Observation	Possible cause	Comments and actions
    No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

13. Guppy – unusually slow processing on a GPU computer

    Observation	Possible cause	Comments and actions
    Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.