- Materials
-
- 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA
- cDNA-PCR Sequencing Kit (SQK-PCS111)
- Custom-ordered sequence-specific primer
- Consumables
-
- Agencourt AMPure XP beads (Beckman Coulter™ cat # A63881)
- 1.5 ml Eppendorf DNA LoBind tubes
- 0.2 ml thin-walled PCR tubes
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Freshly prepared 70% ethanol in nuclease-free water
- 10 mM dNTP solution (e.g. NEB N0447)
- LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S)
- Maxima H Minus Reverse Transcriptase (200 U/µl) with 5x RT Buffer (ThermoFisher, cat # EP0751)
- RNaseOUT™, 40 U/μl (Life Technologies, cat # 10777019)
- Exonuclease I (NEB, Cat # M0293)
- Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
- Qubit dsDNA HS Assay Kit (ThermoFisher, cat # Q32851)
- Qubit™ Assay Tubes (Invitrogen, Q32856)
- Equipment
-
- Hula mixer (gentle rotator mixer)
- Magnetic rack, suitable for 1.5 ml Eppendorf tubes
- Microfuge
- Vortex mixer
- Thermal cycler
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
- Ice bucket with ice
- Timer
- Qubit fluorometer (or equivalent for QC check)
- Pre-chilled freezer block at -20° C for 200 µl tubes (e.g. Eppendorf cat # 022510509)
- Optional equipment
-
- Agilent Bioanalyzer (or equivalent)
-
For this protocol, you will need 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA.
-
Sequence-specific primer sequence
The cDNA RT Adapter (CRTA) supplied in the cDNA-PCR Sequencing Kit (SQK-PCS111) is designed to ligate to poly(A) tailed RNAs. However, you can design your own primer to target a specific RNA sequence (for example, to only sequence 16S rRNA) for subsequent cDNA sequencing.
To perform this type of targeting, order the oligo below, replacing the [sequence-specific] region with ~22 bases complementary to the 3' end of your target RNA sequence. Please note that the exact number of bases may need to be optimised depending on the sequence targeted.
5' - ACTTGCCTGTCGCTCTATCTTC - [sequence-specific] - 3'
We recommend starting with a stock concentration of 2 μM. However, you may find it useful to perform a titration of different primer concentrations. All primers should be HPLC purified.
-
Input RNA
It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.
For further information on using RNA as input, please read the links below.
- Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
- RNA contaminants
- RNA stability
- RNA Integrity Number (RIN)
- Enrichment of polyadenylated RNA molecules
These documents can also be found in the DNA/RNA Handling page.
-
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
-
cDNA-PCR Sequencing Kit (SQK-PCS111) contents
Name Acronym Cap colour No. of vials Fill volume per vial (µl) Strand Switching Primer II SSPII Violet 1 20 µl RT Primer RTP Yellow 1 10 µl cDNA RT Adapter CRTA Amber 1 10 µl Rapid Adapter T RAP T Green 1 10 µl Annealing Buffer AB Orange 1 10 µl cDNA Primer cPRM White cap, grey label 1 40 µl Elution Buffer EB Black 1 500 µl Short Fragment Buffer SFB Clear 1 1,800 µl Sequencing Buffer II SBII Red 1 500 µl Loading Beads II LBII Pink 1 360 µl Loading Solution LS White cap, pink label 1 400 µl Flush Buffer FB Blue 6 1,170 µl Flush Tether FLT White cap, purple label 1 200 µl