-
Primer design
To carry out this custom PCR UMI amplification, you are required to design and order UMI tagging primers with gene specific primer (GSP) sequences incorporated. We strongly recommend the use of Primer3Plus to facilitate primer design for the given target. After identifying a target locus, we recommend adhering to the following parameters when designing custom primers:
- Target amplicon length of 130 — 1000 bp long
- Primer length of ~20 — 25 bp long
- Minimal secondary structure, self-complementary, or crosstalk
- Melting temperature of ~60°C, with no more than 3°C difference in melting temperature between the forward primer and reverse primer
Once a suitable primer pair has been identified, the sequence may be incorporated into the GSP UMI primer sequences below. Substitute the bold 3'N region with the corresponding orientation of GSP sequence.
Note: it is critical that the forward GSP sequence is added to the forward UMI primer sequence and vice versa; failure to do so will result in no target amplification.
Primer name Length Primer sequences GSP UMI fwd 71 - 76 bp GTATCGTGTAGAGACTGCGTAGGTTTVVVVTTVVVVTTVVVVTTVVVVTTT NNNNNNNNNNNNNNNNNNNN GSP UMI rev 70 - 75 bp AGTGATCGAGTCAGTGCGAGTGTTTVVVVTTVVVVTTVVVVTTVVVVTTT NNNNNNNNNNNNNNNNNNNN UVP fwd 60 bp GGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGTTAACCGTATCGTGTAGAGACTGCGTAGG UVP rev 59 bp GGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGTTAACCAGTGATCGAGTCAGTGCGAGTG With the GSP sequence incorporated into the UMI primer sequence, proceed to order the custom UMI primers, as well as the UVP oligos in the table above. Synthesis of pure, full length oligos is essential, therefore users are advised to order the UMI oligos with PAGE purification, resuspended to 100 μM in TE buffer.