- Materials
-
- Rapid PCR Barcoding Kit (SQK-RPB004)
- Consumables
-
- Lysing Matrix D, 2 ml tube (MP Biomedical, cat # 116913050-CF)
- HL-SAN nuclease (ArcticZymes Technologies, cat #70910-202)
- MagNA Pure Bacteria Lysis Buffer (Roche, cat # 04659180001)
- Agencourt AMPure XP Beads (Beckman Coulter™, A63881)
- Freshly prepared 70% ethanol in nuclease-free water
- LunaScript™ RT SuperMix Kit (NEB, cat # E3010)
- Applied Biosystems™ Sequenase Version 2.0 DNA Polymerase (Thermo Fisher, cat # 15809896)
- Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
- Qubit dsDNA HS Assay Kit (Invitrogen, Q32851)
- Qubit™ Assay Tubes (Invitrogen, Q32856)
- LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
- 10 mM Tris-HCl pH 8.0 with 50 mM NaCl
- 0.2 ml PCR tubes
- 1.5 ml Eppendorf DNA LoBind tubes
- Equipment
-
- TissueLyser LT (QIAGEN, cat # 85600)
- Hula mixer (gentle rotator mixer)
- Thermomixer (Eppendorf, Cat# 5382000031)
- Magnetic rack
- Microfuge
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
- Ice bucket with ice
- Timer
- Qubit fluorometer (or equivalent for QC check)
-
For this metagenomic protocol, you will need to extract your RNA/DNA from the clinical sample in viral transport media and take forward 1–5 ng high molecular weight genomic DNA into the library preparation step.
-
Clinical sample swabs should be collected in viral transport media to maintain the viral sample for extraction.
During development of this method, primarily nasopharyngeal swabs were tested. However, swabs from skin lesions were also found to yield virus in patients diagnosed with mpox, suggesting swabs from multiple sites can be used with this method to detect for presence of a virus.
-
Input RNA and DNA
How to QC your input DNA/RNA
It is important that the input meets the quantity and quality requirements. Using too little or too much DNA/RNA, or DNA/RNA of poor quality (e.g. highly fragmented or containing chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Chemical contaminants
DNA input
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can effect library preparation efficiency and sequencing quality.
For further information on using DNA as input, please read the links below:
- Contaminants
- DNA stability - storage
- DNA library stability - Ligation Sequencing Kit (SQK-LSK109)
- DNA stability - freeze-thawing
- DNA fragmentation
RNA input
It is important that the input RNA meets the quantity and quality requirements for highest library preparation efficiency and sequencing quality.
For further information on using RNA as input, please read the links below.
- Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
- RNA Contaminants
- RNA stability
- RNA Integrity Number (RIN)
- Enrichment of polyadenylated RNA molecules
These documents can also be found in the DNA/RNA Handling page.
-
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
-
Rapid PCR Barcoding Kit (SQK-RPB004) contents
Name Acronym Cap colour No. of vials Fill volume per vial (µl) Fragmentation Mix FRM Brown 3 30 Rapid Adapter RAP Green 1 10 Sequencing Buffer SBQ Red 1 300 Loading Beads LB Pink 1 360 Rapid Barcode Primer 1-12 RLB 01-12 Clear 12 10 -
Flow Cell Priming Kit (EXP-FLP002) contents
Name Acronym Cap colour No. of vial Fill volume per vial (μl) Flush Buffer FB Blue 6 1,170 Flush Tether FLT Purple 1 200 -
Rapid Barcode Primer sequences
Component Sequence RLB01 AAGAAAGTTGTCGGTGTCTTTGTG RLB02 TCGATTCCGTTTGTAGTCGTCTGT RLB03 GAGTCTTGTGTCCCAGTTACCAGG RLB04 TTCGGATTCTATCGTGTTTCCCTA RLB05 CTTGTCCAGGGTTTGTGTAACCTT RLB06 TTCTCGCAAAGGCAGAAAGTAGTC RLB07 GTGTTACCGTGGGAATGAATCCTT RLB08 TTCAGGGAACAAACCAAGTTACGT RLB09 AACTAGGCACAGCGAGTCTTGGTT RLB10 AAGCGTTGAAACCTTTGTCCTCTC RLB11 GTTTCATCTATCGGAGGGAATGGA RLB12A GTTGAGTTACAAAGCACCGATCAG -
The RAP Top-Up Kit (EXP-RAP001) is available to provide enough reagents for another six reactions depending on how the barcodes are used.
This kit contains reagents to be used with any remaining barcodes to load another six sequencing libraries.
Reagent Acronym Cap colour No. of vials Fill volume per vial (µl) Rapid Adapter RAP Green 1 10 Sequencing Tether SQT Purple 1 10 Loading Beads LB Pink 1 360 Sequencing Buffer SQB Red 1 300