- Materials
-
- 1 µg of total RNA in 8.5 µl
- Custom-ordered sequence targeted reverse transcription adapter
- Direct RNA Sequencing Kit (SQK-RNA004)
- Consumables
-
- SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, cat # 18080044)
- 10 mM dNTP solution (e.g. NEB, cat # N0447)
- NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
- T4 DNA Ligase 2M U/ml (NEB, cat # M0202T/M)
- RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen, 10777019)
- Agencourt RNAClean XP beads (Beckman Coulter™, cat # A63987)
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Freshly prepared 70% ethanol in nuclease-free water
- 0.2 ml thin-walled PCR tubes
- 1.5 ml Eppendorf DNA LoBind tubes
- Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
- Qubit 1x dsDNA BR Assay Kit (ThermoFisher, cat # Q33265)
- Qubit™ Assay Tubes (Invitrogen, Q32856)
- Equipment
-
- Hula mixer (gentle rotator mixer)
- Magnetic rack, suitable for 1.5 ml Eppendorf tubes
- Microfuge
- Vortex mixer
- Ice bucket with ice
- Timer
- Thermal cycler
- Qubit fluorometer (or equivalent for QC check)
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
- Eppendorf 5424 centrifuge (or equivalent)
-
For this protocol, you will need 1 µg of total RNA in 8.5 µl
-
Input RNA
It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.
For further information on using RNA as input, please read the links below.
- Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
- RNA contaminants
- RNA stability
- RNA Integrity Number (RIN)
- Enrichment of polyadenylated RNA molecules
These documents can also be found in the DNA/RNA Handling page.
-
Custom-ordered sequence targeted reverse transcription adapter sequence
The Reverse Transcription Adapter (RTA) supplied in the Direct RNA Sequencing kit is designed to ligate to any RNA with a poly(A) tail. However, the RTA is a modular component and users can design their own sequence targeted reverse transcription adapter to target a specific RNA sequence (for example, to only ligate to 16S rRNA).
To perform this type of sequence-targeted adapter ligation, order oligo A and a version of oligo B where the 10(dT) sequence at the 3' end is replaced with 10 bases complementary to the 3' end of your target RNA sequence (oligo sequences and reverse transcription adapter structure provided below). Both oligo A and oligo B are DNA.
Anneal oligo A and oligo B 1:1 at 1.4 µM in buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl) by heating to 95º C for 2 minutes and letting them cool down slowly (0.1º C/sec). This directly replaces RTA in the protocol.
Sequences:
Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)Replace the 10(dT) sequence with 10 bases complementary to the 3' end of your target RNA sequence. All oligos should be HPLC purified.
-
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
-
Direct RNA Sequencing Kit (SQK-RNA004) contents:
Name Acronym Cap colour No. of vials Fill volume per vial (μl) RT Adapter RTA Blue 1 10 RNA Ligation Adapter RLA Green 1 45 RNA CS RCS Yellow 1 25 Wash Buffer WSB Orange 2 1,200 RNA Elution Buffer REB Black 1 300 Library Solution LIS White cap, pink label 1 600 Sequencing Buffer SB Red 1 700 RNA Flush Tether RFT Pink 1 200 Flow Cell Flush FCF White 1 8,000 Note: The RNA CS (RCS) is the calibration strand and contains the Enolase II from YHR174W, extracted from the yeast saccharomyces cerevisiae. The reference FASTA files for the yeast is available here.