-
Direct RNA Sequencing Kit features
This kit is highly recommended for users who:
- are exploring attributes of native RNA such as modified bases.
- would like to remove RT or PCR bias.
- have transcripts that are difficult to reverse transcribe.
-
Introduction to the sequence-specific Direct RNA Sequencing protocol
This protocol describes how to carry out sequence-specific sequencing of native RNA using the Direct RNA Sequencing Kit (SQK-RNA004). Starting from total RNA, a second complementary cDNA strand is synthesised for stability by reverse transcription with a custom-ordered sequence targeted reverse transcription adapter. Sequencing adapters are then attached to the RNA-cDNA hybrid for sequencing on either MinION or PromethION RNA Flow Cells (FLO-MIN004RA / FLO-PRO004RA respectively). Please note, the complementary cDNA strand is not sequenced, but improves the RNA sequencing output.
This protocol is designed for sequencing specific RNA (e.g. 16 rRNA) but cannot target specific mRNA of interest. To proceed with this protocol, you will need to order custom oligos, including one that is complementary to the 3' end of the target RNA sequence. These oligos will replace the Reverse Transcription Adapter (RTA) normally used for direct RNA sequencing. For further information on how to design custom RTA, please see the Equipment and Consumables section. Below are the oligo sequences required, with the RNA 3' end-specific sequences in parenthesis:
Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)We recommend a control experiment using the RNA Control Strand (RCS) is completed first to become familiar with the technology.
Steps in the sequencing workflow:
Prepare for your experiment
You will need to:
- Extract your RNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
- Ensure you have your sequencing kit, the correct equipment and third-party reagents
- Download the software for acquiring and analysing your data
- Check your flow cell(s) to ensure it has enough pores for a good sequencing run
Library preparation
You will need to:
- Synthesise the complementary strand of the RNA with your custom-ordered adapter
- Attach sequencing adapters to the ends of the RNA-cDNA hybrid
- Prime the flow cell, and load your RNA library into the flow cell
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software, which will collect raw data from the device and basecall the reads