- Materials
-
- Custom primer mix, 10 μM (IDT) - see below for sequences
- Consumables
-
- 0.2 ml thin-walled PCR tubes
- LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
- Freshly prepared 80% ethanol in nuclease-free water
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Agencourt AMPure XP beads (Beckman Coulter™ cat # A63881)
- 1.5 ml Eppendorf DNA LoBind tubes
- Equipment
-
- Thermal cycler
- Ice bucket with ice
- Magnetic rack, suitable for 1.5 ml Eppendorf tubes
- Hula mixer (gentle rotator mixer)
- Vortex mixer
-
Custom primer mix sequences
Please order these sequences at 10 μM from IDT:
Forward primer: 5’ CAATTCGGTCTCCAGTGACTTGCCTGTCGCTCTATCTTC 3’
Reverse Primer: 5’ CAATTCGGTCTCCCACTTTTCTGTTGGTGCTGATATTGC 3’ -
Split the sample into 2x 48 µl aliquots, and prepare the following reaction in duplicate.
-
In a 0.2 ml thin-walled PCR tube, mix the following:
Reagent Volume LongAmp Taq 2x Master Mix 50 µl Custom primer mix 2 µl Template DNA 48 µl Total 100 µl -
Amplify using the following cycling conditions:
Cycle step Temperature Time No. of cycles Initial denaturation 95°C 3 mins 1 Denaturation 98°C 20 secs 14 (b) Annealing 62°C (a) 15 secs (a) 14 (b) Extension 65°C (c) 3 mins 14 (b) Final extension 65°C 3 mins 1 Hold 4°C ∞ a. This is specific to the primer mix and should be maintained
b. Adjust accordingly if input quantities are altered
c. This temperature is determined by the type of polymerase that is being used (given here for LongAmp Taq polymerase)
-
Place the amplified sample on a magnetic rack. Once the solution is clear, transfer the supernatant into a clean 1.5 ml Eppendorf DNA Lo-Bind tube. The beads can now be discarded.
-
Resuspend the AMPure XP beads by vortexing.
-
Add 180 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.
-
Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
-
Prepare sufficient fresh 80% ethanol in nuclease-free water.
-
Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
-
Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
-
Repeat the previous step.
-
Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
-
Remove the tube from the magnetic rack and resuspend pellet in 25 µl nuclease-free water. Incubate for 2 minutes at room temperature.
-
Pellet the beads on a magnet until the eluate is clear and colourless.
-
Remove and retain 25 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube. Pool the two samples together to yield 50 µl eluted sample.
-
Quantify 1 µl of eluted sample using a Qubit fluorometer.
-
Run a 1 μl aliquot on an Agilent Bioanalyzer to determine fragment length.
The fragment length distribution is expected to be similar to the trace below: