- Materials
-
- 100 ng Poly(A)+ RNA OR 1 µg of total RNA
- Ligation Sequencing Kit V14 (SQK-LSK114)
- Consumables
-
- User-supplied VN Primer, 2 µM
- User-supplied Strand-Switching Primer, 10 µM
- User-supplied PR2 Primer, 10 µM
- NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing (NEB, E7180S or E7180L).
Alternatively, you can use the NEBNext® products below:
- NEBNext® Ultra II End Repair / dA-tailing Module (NEB, E7546)
- NEBNext Quick Ligation Module (NEB, E6056)
- 1.5 ml Eppendorf DNA LoBind tubes
- 0.2 ml thin-walled PCR tubes
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Freshly prepared 80% ethanol in nuclease-free water
- 10 mM dNTP solution (e.g. NEB N0447)
- LongAmp Taq 2X Master Mix (e.g. NEB M0287)
- Maxima H Minus Reverse Transcriptase (200 U/µl) with 5x RT Buffer (ThermoFisher, cat # EP0751)
- RNaseOUT™, 40 U/μl (Life Technologies, cat # 10777019)
- RNase Cocktail Enzyme Mix (ThermoFisher, cat # AM2286)
- Bovine Serum Albumin (BSA) (50 mg/ml) (e.g Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
- Equipment
-
- Hula mixer (gentle rotator mixer)
- Magnetic rack, suitable for 1.5 ml Eppendorf tubes
- Microfuge
- Vortex mixer
- Thermal cycler
- Ice bucket with ice
- Timer
- Pre-chilled freezer block at -20° C for 200 µl tubes (e.g. Eppendorf cat # 022510509)
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
- Optional equipment
-
- Qubit fluorometer (or equivalent for QC check)
-
For this protocol, you will need 100 ng Poly(A)+ RNA or 1 µg of total RNA.
If using alternative cDNA preparation methods, start the protocol with 70–200 fmol of pre-prepared cDNA at the cDNA repair and end-prep step.
-
This protocol requires primer oligos to be ordered separately:
Oligo Sequence (5' to 3') Purity recommended Dilution required VN Primer /5phos/ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN HPLC 2 µM Strand-switching Primer TTTCTGTTGGTGCTGATATTGCTmGmGmG HPLC 10 µM PR2 Primer /5Phos/TTTCTGTTGGTGCTGATATTGC HPLC 10 µM Note: mG = 2' O-Methyl RNA bases.
Note: Please ensure your primer oligos are ordered at HPLC purity level for optimal results.
If ordering from IDT, the primer oligos will need to be ordered at a minimum scale of 100 nmole to enable HPLC purification. -
Input RNA
It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.
For further information on using RNA as input, please read the links below.
- Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
- RNA contaminants
- RNA stability
- RNA Integrity Number (RIN)
- Enrichment of polyadenylated RNA molecules
These documents can also be found in the DNA/RNA Handling page.
-
NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing
For customers new to nanopore sequencing, we recommend buying the NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing (catalogue number E7180S or E7180L), which contains all the NEB reagents needed for use with the Ligation Sequencing Kit.
Please note, for this protocol, NEBNext FFPE DNA Repair Mix and NEBNext FFPE DNA Repair Buffer are not required.
-
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
-
Ligation Sequencing Kit V14 (SQK-LSK114) contents
Note: We are in the process of reformatting our kits with single-use tubes into a bottle format.
Single-use tubes format:
Bottle format:
Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.
Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.