-
Direct cDNA Sequencing V14 with SQK-LSK114 features
This protocol is recommended for users who:
- Are interested in exploring novel RNA biology.
- Are looking for splice variant and fusion transcript analysis.
- Do not wish to use PCR.
- Wish to preserve quantitative information in samples likely to be impacted by PCR bias.
- Would like full-length cDNA strands.
- Want to achieve median raw read accuracy of Q20+ (99%) and above.
- Want to optimise their sequencing experiment for output.
-
Introduction to the Direct cDNA sequencing protocol
This protocol describes how to carry out sequencing of cDNA using a reverse transcription and stand-switching method and the Ligation Sequencing Kit V14 (SQK-LSK114).
This protocol requires the use of three oligo primers to be ordered from a third-party (e.g. IDT):
Oligo Sequence (5' to 3') VN Primer /5phos/ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN Strand-switching Primer TTTCTGTTGGTGCTGATATTGCTmGmGmG PR2 Primer /5Phos/TTTCTGTTGGTGCTGATATTGC Note: mG = 2' O-Methyl RNA bases.
- The VN Primer will anchor to the RNA Poly(A)+ tail and prime the first strand synthesis.
- The Strand-switching Primer will anneal to the non-template nucleotides (C’s) of the novel cDNA strand generated from the first strand synthesis, enabling strand switching.
- Following RNA degradation, the PR2 Primer will prime the second strand synthesis of the cDNA sample.
Using this strand-switching method allows for high yields of cDNA library generation from RNA, while also selecting for full-length transcripts.
Steps in the sequencing workflow:
Prepare for your experiment
You will need to:
- Order the three oligo primers from a third-party
- Extract your RNA, and check its length, quantity and purity. Alternatively, you can start with already-prepared cDNA. The quality checks performed during the protocol are essential in ensuring experimental success
- Ensure you have your sequencing kit, the correct equipment and third-party reagents
- Download the software for acquiring and analysing your data Check your flow cell to ensure it has enough pores for a good sequencing run
Library preparation
You will need to:
- Using the strand-switching protocol, prepare full-length cDNAs from Poly(A)+ RNA
- Ligate sequencing adapters to the cDNA
- Prime the flow cell, and load your cDNA library into the flow cell
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
- (Optional): Start the EPI2ME software and select a workflow for further analysis, e.g. Fastq yeast transcriptome analysis