- Materials
-
- 30 ng DNA
- PCR Sequencing Kit (SQK-PSK004)
- Forward primer: 5’ – TTTCTGTTGGTGCTGATATTGC – your primer sequence – 3’
- Reverse primer: 5’ – ACTTGCCTGTCGCTCTATCTTC – your primer sequence – 3’
- Consumables
-
- 0.2 ml thin-walled PCR tubes
- 1.5 ml Eppendorf DNA LoBind tubes
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S)
- Agencourt AMPure XP beads (Beckman Coulter™, A63881)
- Freshly prepared 70% ethanol in nuclease-free water
- 10 mM Tris-HCl pH 8.0 with 50 mM NaCl
- Equipment
-
- Thermal cycler
- Microfuge
- Magnetic rack
- Ice bucket with ice
- Hula mixer (gentle rotator mixer)
- Qubit fluorometer (or equivalent for QC check)
-
Prepare the DNA in nuclease-free water.
- Transfer a sufficient amount DNA into a DNA LoBind tube
- Adjust the volume to 30 ng/μl with nuclease-free water (you will need ~30 ng for the library prep)
- Mix by flicking the tube to avoid unwanted shearing
- Spin down briefly in a microfuge
-
In a 0.2 ml thin-walled PCR tube, mix the following:
Reagent Volume Template DNA 30 ng Forward primer (user-supplied) 50 nM Reverse primer (user-supplied) 50 nM WGP from the SQK-PSK004 kit, at 10 µM 1.5 μl LongAmp Hot Start Taq 2X Master Mix 25 μl Nuclease-free water up to 50 μl Total 50 μl -
Mix gently by flicking the tube, and spin down.
-
Amplify using the following cycling conditions:
Cycle step Temperature Time No. of cycles Initial denaturation 94 °C 1 min 1 Denaturation 94 °C 30 secs 5 (Denature,Anneal,Extend) Annealing Temperature defined by user-supplied oligo sequence 30 secs Extension 65 °C 50 secs/kb Denaturation 94 °C 30 secs 30 (Denature,Anneal, Extend) Annealing 62 °C 30 secs Extension 65 °C 50 secs/kb Final extension 65 °C 5 mins 1 Hold 4 °C ∞ -
Resuspend the AMPure XP beads by vortexing.
-
Transfer the sample to a 1.5 ml DNA LoBind Eppendorf tube.
-
Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.
-
Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
-
Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
-
Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.
-
Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.
-
Repeat the previous step.
-
Spin down and place the tube back on the magnet. Pipette off any residual 70% ethanol. Briefly allow to dry.
-
Remove the tube from the magnetic rack and resuspend pellet in 10 µl of 10 mM Tris-HCl pH 8.0 with 50 mM NaCl. Incubate for 2 minutes at room temperature.
-
Pellet the beads on the magnet until the eluate is clear and colourless.
-
Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
- Dispose of the pelleted beads
-
Quantify 1 µl of eluted sample using a Qubit fluorometer.
-
Add 1 μl RAP to the 10 μl amplified DNA library.
-
Mix gently by flicking the tube, and spin down.
-
Incubate the reaction for 5 minutes at room temperature.