- Materials
-
- 30 ng DNA
- PCR Sequencing Kit (SQK-PSK004), or
- PCR Barcoding Kit (SQK-PBK004)
- Flow Cell Priming Kit (EXP-FLP002)
- Forward primer: 5’ – TTTCTGTTGGTGCTGATATTGC – your primer sequence – 3’
- Reverse primer: 5’ – ACTTGCCTGTCGCTCTATCTTC – your primer sequence – 3’
- Consumables
-
- 1.5 ml Eppendorf DNA LoBind tubes
- 0.2 ml thin-walled PCR tubes
- Agencourt AMPure XP beads (Beckman Coulter™, A63881)
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Freshly prepared 70% ethanol in nuclease-free water
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette tips
- P10 pipette and tips
- P2 pipette tips
- LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S)
- 10 mM Tris-HCl pH 8.0 with 50 mM NaCl
- Equipment
-
- Microfuge
- P1000 pipette and tips
- P200 pipette
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette
- P2 pipette and tips
- Timer
- Thermal cycler
- Magnetic rack
- Ice bucket with ice
- Hula mixer (gentle rotator mixer)
- Optional equipment
-
- Qubit fluorometer (or equivalent for QC check)
-
For this protocol, you will need 30 ng DNA.
-
Input DNA
How to QC your input DNA
It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Chemical contaminants
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.
-
PCR Sequencing Kit contents
Name Acronym Cap colour No. of vials Fill volume per vial (µl) Whole Genome Primers WGP Grey 1 10 PCR Adapter PCA Blue 1 140 Rapid Adapter RAP Green 1 10 Loading Beads LB Pink 1 360 Sequencing Buffer SQB Red 1 300 -
PCR Barcoding Kit contents
Name Acronym Cap colour No. of vials Fill volume per vial (µl) Barcode Adapter BCA Blue 3 260 Rapid Adapter RAP Green 1 10 Loading Beads LB Pink 1 360 Sequencing Buffer SQB Red 1 300 Barcode Primer 01-12 BP01-BP12 Clear 12 10 -
Flow Cell Priming Kit contents (EXP-FLP002)
Name Acronym Cap colour No. of vials Fill volume per vial (μl) Flush Buffer FB Blue 6 1,170 Flush Tether FLT Purple 1 200 -
The RAP Top-Up Kit (EXP-RAP001) is available to provide enough reagents for another six reactions depending on how the barcodes are used.
This kit contains reagents to be used with any remaining barcodes to load another six sequencing libraries.
Reagent Acronym Cap colour No. of vials Fill volume per vial (µl) Rapid Adapter RAP Green 1 10 Sequencing Tether SQT Purple 1 10 Loading Beads LB Pink 1 360 Sequencing Buffer SQB Red 1 300