- Materials
-
- 10 ng of cDNA amplicons prepared using 10X Genomics Next GEM Single Cell 3' Kits (V3.1)
- cDNA-PCR Sequencing Kit (SQK-PCS111)
- Custom-ordered oligo at 10 μM: [Btn]Fwd_3580_partial_read1_defined (sequence provided below)
- Custom-ordered oligo at 10 μM: Rev_PR2_partial_TSO_defined_for_5'_cDNA (sequence provided below)
- Consumables
-
- M280 streptavidin, 10 μg/μl (Invitrogen, 11205D)
- LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S)
- Agencourt AMPure XP beads (Beckman Coulter™, A63881)
- 1 M Tris-HCl, pH 7.5
- 5 M NaCl (Sigma, 71386)
- 0.5 M EDTA, pH 8 (Thermo Scientific, R1021)
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Freshly prepared 70% ethanol in nuclease-free water
- Agilent Technologies DNA 12000 Kit
- 1.5 ml Eppendorf DNA LoBind tubes
- 0.2 ml thin-walled PCR tubes
- 15 ml Falcon tubes
- Equipment
-
- Hula mixer (gentle rotator mixer)
- Magnetic rack (e.g. Invitrogen DynaMag-2 Magnet, Cat # 12321D)
- Microfuge
- Vortex mixer
- Thermal cycler
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
- Ice bucket with ice
- Timer
- Qubit fluorometer (or equivalent for QC check)
- Agilent Bioanalyzer (or equivalent)
-
For this protocol, you will need 10 ng amplified cDNA amplicons prepared using 10X Genomics Next GEM Single Cell 3' Kits (V3.1).
-
Input DNA
How to QC your input DNA
It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Chemical contaminants
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.
-
cDNA-PCR Sequencing Kit (SQK-PCS111) contents
Name Acronym Cap colour No. of vials Fill volume per vial (µl) Strand Switching Primer II SSPII Violet 1 20 µl RT Primer RTP Yellow 1 10 µl cDNA RT Adapter CRTA Amber 1 10 µl Rapid Adapter T RAP T Green 1 10 µl Annealing Buffer AB Orange 1 10 µl cDNA Primer cPRM White cap, grey label 1 40 µl Elution Buffer EB Black 1 500 µl Short Fragment Buffer SFB Clear 1 1,800 µl Sequencing Buffer II SBII Red 1 500 µl Loading Beads II LBII Pink 1 360 µl Loading Solution LS White cap, pink label 1 400 µl Flush Buffer FB Blue 6 1,170 µl Flush Tether FLT White cap, purple label 1 200 µl -
Custom-ordered oligo sequences
Order the following HPLC-purified oligos at 100 μM, and dilute to 10 μM in TE buffer for use in the Pre-pull-down step of the library prep.
Name Sequence [Btn]Fwd_3580_partial_read1_defined 5'-/5Biosg/CAGCACTTGCCTGTCGCTCTATCTTC
CTACACGACGCTCTTCCGATCT-3'Rev_PR2_partial_TSO_defined 5'-CAGCTTTCTGTTGGTGCTGATATTGCAAGCAGTGGTA
TCAACGCAGAG-3'