-
The VSK-VPS001 RNA library preparation kit
The VolTRAX RT-PCR Sequencing Kit 1-12 generates PCR amplicons from the user's input RNA using the VolTRAX V2b platform to improve consistency in library preparation due to the precise fluid handling of the device.
This kit provides the reagents required to generate reverse-transcribed and PCR-amplified material from RNA samples using VolTRAX automation to prepare the library. The user provides their own PCR primers to generate custom amplicons, before barcoding and pooling multiple samples together for sequencing. We recommend using 10 mM Tris-HCl pH 8.0 as a buffer for the primers, and using the VolTRAX device to optimise the PCR conditions. When loading PCR primers onto the VolTRAX, we recommend loading at 3X the desired reaction concentration.
Below is an overview of the library preparation stages using a VolTRAX V2b, blue cartridges and the VolTRAX RT-PCR Sequencing Kit 1-12 (VSK-VPS001).
-
Overview of the VolTRAX RT-PCR Sequencing Kit 1-12 protocol
1. Loading a protocol
- Use the protocol selector in the UI to load the VolTRAX RT-PCR Sequencing Kit 1-12 protocol.
- When prompted, connect your VolTRAX V2b device, press Continue and await connection.
2. System QC - Cartridge Test
- When prompted, connect a cartridge to the VolTRAX device and press Continue to proceed to the Cartridge Test.
3. Loading the Priming Fluid and reagents into the cartridge
- Follow the instructions on the equipment required and pipetting technique.
- Prime the cartridge by twisting the oil container and removing the foil tab.
- Load the appropriate reagents, custom primers and extracted RNA into the ports as instructed by the UI.
- You will be given the option to adjust the PCR timings and temperatures to allow you to use custom primers.
- The reagents will be manipulated by the VolTRAX V2b to prepare the library for nanopore sequencing.
4. Extracting the library from the cartridge
- Follow the extraction instructions, using UI as a visual guide, to slowly extract the library from the cartridge, then transfer it into an Eppendorf tube.
- Prepare the library for loading onto the flow cell.
-
VolTRAX RT-PCR Sequencing Kit 1-12 (VSK-VPS001) contents
Name Acronym Cap colour Number of vials Fill volume per vial (µl) LunaScript RT SuperMix LS RT Blue 1 10 Q5 HS Master Mix Q5 Orange 1 35 VX BC Frag Mix VXB01-12 Amber 12 10 VX AMPure XP Beads VXP Pink 1 45 VX Rapid Adapter F VRA F Green 1 12 VX Elution Buffer VELB Black 1 50 VX Running Buffer VRB Red 1 250 Negative Control NEG Clear 1 10 Flush Buffer FB Blue 3 1170 Flush Tether FLT White cap, purple label 1 200 -
VolTRAX RT-PCR Sequencing Kit 1-12 barcode sequences
Component Sequence VXB01 AAGAAAGTTGTCGGTGTCTTTGTG VXB02 TCGATTCCGTTTGTAGTCGTCTGT VXB03 GAGTCTTGTGTCCCAGTTACCAGG VXB04 TTCGGATTCTATCGTGTTTCCCTA VXB05 CTTGTCCAGGGTTTGTGTAACCTT VXB06 TTCTCGCAAAGGCAGAAAGTAGTC VXB07 GTGTTACCGTGGGAATGAATCCTT VXB08 TTCAGGGAACAAACCAAGTTACGT VXB09 AACTAGGCACAGCGAGTCTTGGTT VXB10 AAGCGTTGAAACCTTTGTCCTCTC VXB11 GTTTCATCTATCGGAGGGAATGGA VXB12 CAGGTAGAAAGAAGCAGAATCGGA -
VSK-VPS001 chemistry
The VolTRAX RT-PCR Sequencing Kit 1-12 generates amplicons across target regions or organisms of interest within the extracted RNA sample. First, the RNA samples are reverse-transcribed and then amplified by PCR using the user-defined primers. The samples are purified with AMPure XP beads before tagmenting the DNA amplicons with the Rapid Barcodes, adding the sequencing adapter and pooling for sequencing.